Спутник технологический. ADRV. [Редактировать]

Согласно  сообщению китайской  прессы данный аппарат Китай планирует использовать для отработки технологии удаления мусора с орбиты.

Дополнительные наименования

#НаименованияПоиск в новостяхПоиск в документах
1Aolong 1НайтиНайти

Дополнительная классификация

#Наименования
1Страна оператор(владелец) - Китай
2Страна производитель - Китай
3Тип орбиты - НОО
4Тип оператора(владельца) - государственный

Информация об удачном запуске

#ХарактеристикаЗначение
1Космодром Венчанг
2Дата пуска2016-06-25
3Полезная нагрузка 1xTiange Feixingqi 2
4Полезная нагрузка 1xTiange Feixingqi 1
5Полезная нагрузка 1xBallast
6Полезная нагрузка 1xADRV
7Полезная нагрузка 1xZGZ Shiyan Zhuangzhi
8Полезная нагрузка 1xAoxiang Zhixing
9Полезная нагрузка 1xCMS Capsule Test
10Ракета-носитель 1xВеликий Поход 7

Найдено 58 документов по запросу «ADRV». [Перейти к поиску]


Дата загрузки: 2017-01-10
Скачать документ
0.09/5
... Rule 40.12, where applicable. *ADRV: Anti-Doping Rule Violation **AAF... Date of infraction Nat. Sex ADRV* Sanction Ineligibility until ABITOVA Inga... 26.2.10 Life ban (2nd ADRV) Life ban ANDREEV Andrian BUL....02.08 Life ban (2nd ADRV) Life ban ANTIL Akash IND... 8.09.07 Life ban (2nd ADRV) Life ban BANERJEE Bodhisatva IND... as from 10.3.09 (3rd ADRV) Lifeban BARNARD Charmaine RSA F AAF... Yahya MAR M AAF – EPO (2nd ADRV) 23.11.11 4 years ineligibility....08.08 Life ban (2nd ADRV) Life ban BONSUMUSO Mbatha RSA....08 10 years ineligibility (2nd ADRV) 17 August 2018 CASTILLO Victor... – EPO 3.8.11 5 years ineligibility (2nd ADRV) DARDHA Marisda ALB F AAF - Clenbuterol....6.12 10 years ineligibility (2nd ADRV) 12 July 2022 GIRI P.B. IND... 25.1.10 8 years ineligibility (2nd ADRV) 20 July 2018 GOGAI Suraj... 19.1.12 8 years ineligibility (2nd ADRV) 18 January 2020 HESCH Christian....11.09 8 years ineligibility (2nd ADRV) 30 August 2018 JING Wang....08.04 Life ban (2nd ADRV) Life ban KID ALLAH Khalid....05.08 Life ban (2nd ADRV) Life ban KORB Nelson BRA....12.11 8 years ineligibility (2nd ADRV) 2 years ineligibility KUMAR Nitin IND....11.07 Life ban (2nd ADRV) Life ban LING Yee Yi... 25.2.11 Life ban (2nd ADRV) Life ban MORTILLARO Corrado ITA... 24.6.11 Life ban (2nd ADRV) Life ban NAIMOVA Tezdzhan BUL... – Drostanolone 3.3.13 Life ban (2nd ADRV) Life ban NIKITIN Vladimir RUS....03.04 Life ban (2nd ADRV) Life ban PETLYUK Tetiana UKR....5.12 10 years ineligibility (2nd ADRV) 1 November 2022 PISKUNOV Vladyslav UKR....08.05 Life ban (2nd ADRV) Life ban POLYCHRONIOU Christos GRE....2 (c) 18.3.08 Life ban (2nd ADRV) Life ban PUSHPARAJU P IND M AAF....10.10 Lifetime ban (2nd ADRV) As from 4 November 2010 SINGH... 25.6.10 8 years ineligibility (2nd ADRV) 15 August 2018 STEWART Raymond... – Bromantan 29.2.12 Lifeban (2nd ADRV) Lifeban TEXEIRA Rui POR M AAF... methandienone 3.6.09 8 years ineligibility (2nd ADRV) 2 September 2017 VASHURKIN Alexander RUS... – Hydrochlorothiazide 4.9.11 8 years ineligibility (2nd ADRV) 10 November 2019 VIJ Sourabh....02.05 Life ban (2nd ADRV) Life ban VOLGINA Natalia RUS....07.04 Life ban (2nd ADRV) Life ban YULAMANOVA Nailya RUS...



Дата загрузки: 2017-01-10
Скачать документ
0/5
... an Anti-Doping Rule Violation (“ADRV”) and imposed an eleven-month... 28 August 2008, committed a first ADRV. The DC found that the... a prohibited substance, had committed an ADRV and imposed a two-year period... the First Respondent for a first ADRV (CAS 2013/A/3259). Therefore, Appellant... 29 May 2012 constitutes a first ADRV and, accordingly, amended its prayers... to be imposed for the ADRV committed on 29 May 2012... 29 May 2012 constitutes an ADRV and, second, which sanction shall... on the Athlete. 1. 40) The ADRV committed on 29 May 2012... anti-doping rules” constitutes an ADRV. This rule, in an identical... that the Athlete committed an ADRV. 48) By refusing to submit... 2012, the Athlete committed an ADRV according to Article 4 of Res...-Doping Code.” 50) For an ADRV committed in the form of... the First Respondent committed an ADRV in 2008 and was sanctioned... 57) The Athlete committed an ADRV in the form of refusing... obtained from the date the ADRV occurred, i.e. 29 May 2012, through...



Дата загрузки: 2016-12-01
Скачать документ
0.12/5
... an Anti-Doping Rule Violation (“ADRV”) and imposed an eleven-month... 28 August 2008, committed a first ADRV. The DC found that the... a prohibited substance, had committed an ADRV and imposed a two-year period... the First Respondent for a first ADRV (CAS 2013/A/3259). Therefore, Appellant... 29 May 2012 constitutes a first ADRV and, accordingly, amended its prayers... to be imposed for the ADRV committed on 29 May 2012... 29 May 2012 constitutes an ADRV and, second, which sanction shall... on the Athlete. 1. 40) The ADRV committed on 29 May 2012... anti-doping rules” constitutes an ADRV. This rule, in an identical... that the Athlete committed an ADRV. 48) By refusing to submit... 2012, the Athlete committed an ADRV according to Article 4 of Res...-Doping Code.” 50) For an ADRV committed in the form of... the First Respondent committed an ADRV in 2008 and was sanctioned... 57) The Athlete committed an ADRV in the form of refusing... obtained from the date the ADRV occurred, i.e. 29 May 2012, through...



Дата загрузки: 2016-12-24
Скачать документ
0/5
... this Anti-Doping Rule Violation (ADRV) pursuant to the FEI’s Anti... prescribed, knowing it was an ADRV, because he wanted to follow... case. 21. Subsequent to the ADRV charge of 24 August 2011... on 7 November 2012, admitting the ADRV along with a request for a hearing... that sufficient proof of an ADRV under Article 2.1 of the ADRHA... of the commission of an ADRV; (2) before having received notice of... collection which could establish an ADRV; and (3) that admission is the... collection which could establish an ADRV. c. At the time of the... the only evidence of the ADRV. The FEI as the author... be a “causal connection” between the ADRV and the admission, as those... knew he was committing an ADRV; he was in a time of... of the commission of an ADRV. Had they done their jobs... action upon learning of a potential ADRV through the December 2009 TUE... Mr Millar did admit the ADRV after being confronted with the..., not knowing it was an ADRV. The tribunal held that this... of the commission of an ADRV for purposes of Article 10... knew he was committing an ADRV by taking the DHEA-s. b. UK... to a voluntary admission of an ADRV for purposes of Article 10... in the sport was an ADRV and nevertheless he continued to... his taking DHEAs was an ADRV. 71. The decisions cited by... facts that amount to an ADRV is the same as admitting the commission of an ADRV. The rule should be read... admit the commission of an ADRV to fall within Article 10... knowledge that it was an ADRV by holding that the rule... conduct which amounts to an ADRV. This is adding an additional... ‘admission of conduct constituting an ADRV’). There was no discussion of... ‘coming forward’ and admitting the ADRV in circumstances where no one... liability for commission of an ADRV, not an acknowledgement (for other... reflect the commission of an ADRV). The FEI submits that this... in November 2012 to an ADRV when confronted by the FEI...



Дата загрузки: 2016-12-25
Скачать документ
0/5
... an Anti-Doping Rule Violation (ADRV) by a charge letter dated 21 November 2014. The ADRV consisted of the presence of... the Anti-Doping Rules. The ADRV was admitted by Mr Burnett... reiterated his acceptance of the ADRV and stated that he "wishes.... Given the admission of the ADRV the only matter to be... Fault or Negligence for the ADRV. 6. Having concluded that Mr Burnett... Fault or Negligence for the ADRV the Panel noted that the... at the time of the ADRV from a moderate level of depression... to the time of the ADRV; -3- 7.3the traumatic life experiences suffered... Fault or Negligence for the ADRV the Period of Ineligibility should... of cognitive impairment and the ADRV. The Commission had before it... impairment, the circumstances of the ADRV and the causative link between... between the impairment and the ADRV. The lack of assistance to... in Livermore found that the ADRV represented the Athlete’s first experience... the circumstances surrounding the ADRV and the ADRV itself: paragraph 33. There... severe cognitive impairment and the ADRV: paragraph 14.4. In contrast, the...” in the commission of the ADRV because of the large amount... Burnett’s moderate depression and the ADRV. The Panel appreciated that this... and the circumstances surrounding the ADRV each case must be looked...



Дата загрузки: 2016-12-24
Скачать документ
0.23/5
... assertion of antidoping rule violation (ADRV). Before you make any decision related to an assertion of ADRV, you should seek independent professional... a formal notification on assertion of ADRV? What is expected from me... notified on an assertion of ADRV? Strict Liability Principle (Comment to... you would: • admit to the ADRV, waive a hearing, and accept the... imposed. * Promptly admitting to an ADRV assertion may result in the... the discovering or establishing an ADRV by another person. This includes... admit the commission of an ADRV before having received notice of... collection which could establish an ADRV and that admission is the... reference purpose only and • The ADRV may be publicly disclosed (Article...



Дата загрузки: 2016-12-25
Скачать документ
0.23/5
ADRV is in pink, TaV in blue, IFV in violet and DHV in khaki, the vertical line and arrow indicates the TaV consensus in the chromatograms ADRV TaV TCTAGATTCTTCGATTCGGTTTGGGTGTACCACTTGGCAAACAGCTCTTGGGTTCGAGATTTAACTAGAGA TaV AGACGTGGAGGAAAATCCCGGGCCCCAC IFV TaV TCTAGACCCTCAATTGGTAATGTCGCGCGGACTCTGACGAGGGCGGAGATTATTGAGGATGAATTGATTCGTG CAGACGTGGAGGAAAATCCCGGGCCCCACC DHV TaV TCTAGAGCATTTGAACTCAATTTGGAAATTGAATCTGACCAAATTAGAAACAAGAAAGATCTCACTACTGAA GACGTGGAGGAAAATCCCGGGCCCCAC 11TaV-9 ADRV TCTAGACGCGCCGAGGGCAGGGGAAGTCTTCTAACATGCGAATGCATTGAATCTAACCCTGGGCCCCAC 12TaV-8 ADRV TCTAGACGCGCCGAGGGCAGGGGAAGTCTTCTAACATGCGGGTGCATTGAATCTAACCCTGGGCCCCAC 12TaV-9 ADRV TCTAGACGCGCCGAGGGCAGGGGAAGTCTTCTAACATGCGGGGAATGCATTGAATCTAACCCTGGGCCCCAC 12TaV-8 IFV TCTAGACGCGCCGAGGGCAGGGGAAGTCTTCTAACATGCGGGGGAATTGAATCAAATCCTGGGCCCCAC



Дата загрузки: 2017-01-10
Скачать документ
0/5
... A.6.2.2. ADRV (Adult diarrhea rotavirus strain) A.6.2.2.1. Epidemiology of ADRV A.6.2.2.2. Experimental infection of ADRV A.6.2.3. CAL... epidemic in China. Manuscript. 3 ABBREVIATIONS ADRV aa ATP bp BSA BTV... by group B adult diarrhea rotavirus (ADRV) isolated from China in 1980s... diarrhea. The recorded symptoms that ADRV patients (5942 cases) suffered in... B rotaviruses Group B rotaviruses include Chinese ADRV (Hung et al., 1983), suckling... encoding segment of IDIR (segment 7), ADRV and CAL (segment 6) contains two...). The recombinant ORF1 product of ADRV (AD6F1, 107 aa) expressed in... offer an explanation for the ADRV-induced cell fusion and syncytia... sequence information of group B rotaviruses (ADRV, 8/11; IDIR, 11/11; CAL... RV AD RV A A.6.2.2. ADRV (Adult diarrhea rotavirus) ADRV is unique among human... mainly infantile and childen diarrhea, ADRV, as the name implies, mainly... adult diarrhea. The cytopathology of ADRV is distinct and is characterized...). The sequence of the eight ADRV genes encoding structural proteins VP2... available in the GenBank. Each ADRV protein shares low identity at... groups. Four structural proteins of ADRV have been expressed in baculovirus... of the viral proteins produced ADRV-like particles that are similar...., 1991). The recombinant assemblies of ADRV may be more useful than... outbreak caused by ADRV in Heilongjiang province in 1982, ADRV has caused...). Interestingly, adult diarrhea caused by ADRV was documented only within Mainland.... Combined strains include NADRV, group B (ADRV, RRV, and IDIR), group A (DS...). To investigate the prevalence of ADRV infection, many studies have been... antibody titer against ADRV. The anti- A.6.2.2.1. Epidemiology of ADRV Outbreaks of adult nonbacterial diarrhea clinically similar to ADRV had... were available (Hung, 34 A. Introduction ADRV isolates circulating in Lanzhou and... al., 1986). The only additional ADRV sequence data available is that... homology is 98.3% for the ADRV strains from Tangshang and Lanzhou... al., 1999 and references therein). ADRV titers of GG collected before... investigations of ADRV prevalence have demonstrated that exposure to ADRV infection is... al; 1987). Very recently, the ADRV antibody positive rate was 3.6% (79... and Hong Kong, a low level ADRV seropositivity were observed in the.... This is consistent with no ADRV epidemics occurring after the 1980s... no obvious difference in the ADRV antibody positive rate between the... from different locations in China, ADRV antibody and/or antibodies cross-reacting with ADRV were most frequently detected in... al., 1987). However, antibodies against ADRV were not detectable in the..., humans are important hosts for ADRV, and domestic animals may also... rotaviruses. The genomic analyses of ADRV isolates circulating in different regions... of the A.6.2.2.2. Experimental infection of ADRV ADRV particles were first discovered by...). To confirm ADRV as the causative pathogen, a human ADRV experimental infection has... orally with fecal filtrates of ADRV. The second group (nine persons... process of an outbreak of ADRV. 35 A. Introduction closely serologically and... the antisera of ADRV and is substantially different from ADRV, with only...., 1991). All these suggest that ADRV and IDIR are different serotypes... segments (4th –9th) (Fig. 6) with ADRV primers (Krishnan et al., 1999... the corresponding putative proteins between ADRV and CAL are: VP2 98... nucleotide level with the corresponding ADRV and IDIR segments encoding putative... after the nucleotide 782 of ADRV. Following the mutation point, the..., which is not typical for ADRV infections. Diarrhoea occurred on average... pattern is obviously different from ADRV 4-2-1-1-1-1-1, with widely separated segments 3 and..., RNA patterns, and serotyping between ADRV and NADRV suggest a novel adult... four subgroup A rotaviruses and group B ADRV strain (Jiang et al., 1992..., adult diarrhoea epidemics caused by ADRV ceased in China. However, in... adult diarrhea epidemics caused by ADRV, several sporadic and an adult... a high fever, which differs from ADRV (Qian et al., 1994). outbreak... epidemiological pattern matches that of ADRV (Hung et al, 1988). The... suffering from gastroenteritis in an ADRV epidemic that occurred in 1986... the typical adult diarrhea rotavirus (ADRV) (IV, Fig. 1). To further characterize... diagnostic primers for the group B ADRV segment 6 (Yang et al., 1998... NADRV and antiserum to group B ADRV, these regions probably do not... three members of group B rotaviruses (ADRV, CAL and IDIR) and between... coinciding with a noticeable decline in ADRV infections in China during the... novel NADRV rotavirus differs from ADRV and other group B rotaviruses, which... equivalent: primary characterization of the ADRV segment 9 RNA. Virol. 178, 311... of the human group B rotavirus ADRV. J Virol. 67, 2730-8. Mackow ER... G. (1993). Baculovirus expression of the ADRV gene 5 encoded protein produces an... of the human group B rotavirus, ADRV. Virol. 201, 162-8. Mackow ER... main genes of group B rotaviruses ADRV and RRV Chin J Microbiol Immunol...



Дата загрузки: 2017-01-10
Скачать документ
0/5
... Cycling Independent Reform Commission ABBREVIATIONS ADRV Anti-Doping Rule Violation CADF... any anti-doping rule violation (ADRV) and provide any information requested... Holder (LH) who admits an ADRV to the CIRC (Reduced Sanctions... provides valuable information concerning other ADRV/s or any other significant anti... CIRC uncovers evidence that an ADRV was committed within the applicable... LH who allegedly committed the ADRV to be heard by the... from asserting jurisdiction over an ADRV governed by the CIRC Regulations... not assert jurisdiction over an ADRV governed by the CIRC Regulations... any other ADO concerning an ADRV within the exclusive jurisdiction of... any LH who admits an ADRV (i.e. Reduced Sanctions) and to reduce... (i.e. Further Reduced Sanctions). B. ADMISSIONS OF ADRV a. Reduced sanctions 39. The following... the CIRC: aa. Riders admitting ADRV/s: (i) Use or possession of prohibited...): 6 months ineligibility period. (iii) Other ADRV/s: 12 months ineligibility period. bb..., drivers (Rider Assistance Personnel) admitting ADRV/s: (i) Possession of prohibited substances or...): 6 months ineligibility period. (ii) Other ADRV/s: 12 months ineligibility period. cc..., coaches (Senior Team Personnel) admitting ADRV/s (i) Possession of prohibited substances or... licensed medical personnel (Practitioners) admitting ADRV/s (i) Possession of prohibited substances or... as a result of the confessed ADRV, if any, and (ii) whether.... If the LH admits an ADRV to the CIRC no return... containing valuable information concerning other ADRV/s or any other significant anti... Reform Commission aa. Riders admitting ADRV/s and providing Additional Valuable Information... exceptional cases, (ii) The admitted ADRV will not be publicly disclosed... Team Personnel and Practitioners admitting ADRV/s and providing Additional Valuable Information..., in exceptional cases, (ii) The ADRV will not be publicly disclosed... and the decision that the ADRV will not be publicly disclosed... the CIRC decides that the ADRV will not be publicly disclosed... as a result of the admitted ADRV, if any. 58. No consequence... the CIRC decides that the ADRV will not be publicly disclosed... Sanction and decides that the ADRV shall not be publicly disclosed... provided under 54(aa)(i). i. Subsequent ADRV 66. If the LH commits an intentional or negligent ADRV concerning a non-specified substance or... to the CIRC (the Additional ADRV) for which he has obtained...“ and/or a ruling that the “ADRV will not be publicly disclosed... the CIRC of the Additional ADRV. 13/17 UCI Ad Hoc... shall not disclose the Admitted ADRV to any ADO investigating or prosecuting the Additional ADRV. It will take the necessary... to ensure that the Admitted ADRV remains confidential also after the... prosecuting the Additional ADRV independently discovers the Admitted ADRV, the CIRC’s Decision... will become ineffective and the ADRV covered by such Decision can... the sanction for the Additional ADRV (in other words, the LH... for the Admitted ADRV but for the Additional ADRV under the aggravated... have been informed of a potential ADRV) at the time of the... the Cycling Independent Reform Commission E. ADRV DISCOVERED BY THE CIRC 69... CIRC uncovers evidence that an ADRV was committed within the applicable... LH who allegedly committed the ADRV to be heard by the... evidence provided to prosecute the ADRV will not be public and... CIRC has decided that the ADRV will not be public and... the details of the admitted ADRV. 78. Any LH who accepts... respect to a LH admitting an ADRV and/or providing additional information... LH who is admitting an ADRV and/or providing information to... LH accepts that the confessed ADRV is officially recorded. (v) The CIRC... includes “non-publication of the ADRV”, the CIRC shall treat the...



Дата загрузки: 2017-01-10
Скачать документ
0/5
... ADRVs** ……………………………………………………………….……….…….……19 Table 1- Non-Analytical ADRV Cases by Sport and Nationality……………………………………………………………………………….20 Table 2- Non-Analytical ADRV Cases by Nationality and Sport...-Doping Administration and Management System ADRV AIMS Anti-Doping Rule Violation... AAFs that resulted in an ADRV plus all non-analytical ADRVs...’s name, etc. ADRV: A decision was rendered and an ADRV was recorded against... 77 5 5 30 2 7 4 6 2 2 347 106 177 ADRV 1119 314 99 72 37... 11 8 1 2 1 1 1 9 3 1 2 27 8 4 21 8 3 1 1 4 1 1 1 5 1 1 5 1 1 7 10 7 10 3 1 1 3 1 1 - ADRV 49 1 2 38 8 2 2 235 199 2 7 1 1 9 1 1 3 7 4 1 1 21... 27 3 29 27 3 1 1 1 1 2 1 1 1 2 1 2 1 8 3 3 8 3 3 5 5 13 3 1 13 2 1 1 3 3 1 1 - ADRV 153 1 7 79 1 11 46 8 1 1 6 1 3 1 1 4 1 2 1 1 1 74... 2 2 7 7 2 2 5 4 5 4 3 1 3 1 8 3 24 8 3 24 1 6 1 6 195 78 96 ADRV 7 7 10 10 8 8 12 1 11 16... 6 6 11 11 1 1 1 1 12 1 2 1 10 30 2 ADRV 7 7 1 1 17 17 1 1 6 2 4 5 3 2 37 * Sports/Disciplines... Pending 3 13 13 3 13 13 1 1 2 1 1 1 1 1 1 4 7 4 7 1 5 1 5 1 1 1 1 1 1 1 1 4 4 1 1 1 1 1 1 2 2 8 8 1 1 1 1 - ADRV 13 13 14 1 11 1 1 6 6 4 3 1 6 6 1 1 5 5 3 2 1 4 4 1 1 5 3 1 1 1 1 1 1 1 1 3 1 2 * Sports... Sanction Pending 1 1 1 1 1 1 2 2 19 19 41 ADRV 3 3 1 1 1 1 3 3 1 1 1 1 10 3 7 11 11 99 Table... Pending 5 12 5 10 1 1 1 1 2 3 2 3 2 2 1 1 1 1 3 3 4 7 4 7 1 1 13 2 27 ADRV 162 127 35 1 1 1 1 3 3 15 1 14... to Answer No Sanction Pending 1 1 1 2 2 1 2 2 2 2 1 1 1 1 6 2 2 ADRV 3 3 5 5 9 9 2 2 3 1 2 22 Table 7- AAF Outcomes by... to Answer No Sanction Pending 1 2 1 2 2 2 2 2 1 1 2 2 1 1 7 4 ADRV 1 1 1 1 1 1 3 3 2 2 8 8 1 1 1 1 6 3 3 24 TUE 5 No Case to Answer No Sanction Pending 76 5 8 ADRV 75 Table 8- AAF Outcomes by... 34 1 5 2 8 1 347 No Sanction Pending ADRV 42 114 1097 50 15... Pending 1 7 19 4 7 6 2 2 3 1 1 1 7 1 1 1 3 1 1 1 34 10 26 ADRV 95 47 32 6 2 3 7 4 4 5 1 2 1 211 ADO... to Answer No Sanction Pending 5 2 1 8 - ADRV 3 1 3 1 8 Table 3- AAF Outcomes by TA... to Answer No Sanction Pending 1 5 1 1 1 2 7 ADRV 2 3 3 2 1 1 12 ADO ADAMS Code IPF... to Answer No Sanction Pending 4 1 3 1 1 8 ADRV 24 16 5 1 1 47 ADO ADAMS... to Answer No Sanction Pending 2 3 1 1 5 1 1 ADRV 8 5 6 5 2 3 1 30 Table 5- AAF Outcomes by... 1 3 22 49 34 1 2 6 12 2 7 2 1 1 2 4 3 1 8 8 1 7 1 3 1 2 4 3 3 3 4 5 1 8 4 1 1 1 1 6 1 1 1 1 1 6 1 2 3 3 11 1 1 1 2 1 1 2 - ADRV 184 144 90 2 15 61... Sanction Pending 2 1 1 1 3 1 3 1 1 1 1 2 1 1 1 1 2 1 1 1 1 1 1 1 1 1 1 158 42 114 ADRV 2 5 4 5 5 1 4 4 4 4 2 3 2 2 2 1 1 2 1 2 1 2 1 1 1 1 1 1 1 1097 * As reported in 2013... to Answer No Sanction Pending - ADRV 5 2 1 1 9 ADO ADAMS Code AFR-RADO... to Answer No Sanction Pending 1 1 1 1 ADRV 1 2 2 1 1 1 8 ADO ADAMS Code EAF LEN... No Sanction Pending 21 1 1 1 3 2 2 2 1 1 1 1 34 3 ADRV 2 1 3 1 1 1 1 1 1 1 1 1 15 ADO ADAMS Code Total... to Answer No Sanction Pending ADRV 84 Table 9- AAF Outcomes by... (ESP-NADO). 2013 ADRVs Report ADRV 45 Page 18 of 66... of 66 Table 1- Non-Analytical ADRV* Cases by Sport and Nationality... JORDAN MALAYSIA ROMANIA TUNISIA TURKEY ADRV Cases 3 1 1 1 45 2 1 2 4 2 3 7 1 3 2 6 1 1 1 1 2 3 2 1 2 2 1 1 2 1 1 2 1 1 60 1 9 2 2 1 1 2 1 5 3 1 1 1 30 Sport... SWITZERLAND Kickboxing BELGIUM Motorsport FINLAND ADRV Cases 7 1 3 1 1 1 3 3 50 1 1 10 1 1 3 2 6 1 2 3 1 11 2 1 1 3 1 1 2 2 12... of 66 Table 1- Non-Analytical ADRV* Cases by Sport and Nationality... KINGDOM Sailing PORTUGAL Shooting PORTUGAL ADRV Cases 1 1 2 1 1 1 1 1 1 5 1 1 2 1 1 1 1 1 11 2 1 1 1 1 1 3 1 4 4 2 2 Sport-Nationality Skiing... NETHERLANDS RUSSIAN FEDERATION Grand Total ADRV Cases 4 1 2 1 1 1 1 1 4 1 1 1 1 16 1 1 13 1 1 1 4 3 1 1 1 9 2 1 1 1 1 3 266 * Including... of 66 Table 2- Non-Analytical ADRV* Cases by Nationality** and Sport... Sports Bodybuilding Motorsport Triathlon ADRV Cases Nationality-Sport ADRV Cases 8 2 2 1 1 2 2 1 1 24 1 9 10... of 66 Table 2- Non-Analytical ADRV* Cases by Nationality** and Sport... SAUDI ARABIA Athletics SERBIA Tennis ADRV Cases 3 3 1 1 2 1 1 8 7 1 1 1 1 1 3 2 1 23 3 3 3 1 2 2 1 1 4 2 1 3 2 1 13 1 6 1 1 1 3 1 1 1 1 1 1 Nationality-Sport... URUGUAY Athletics Cycling Grand Total ADRV Cases 2 1 1 31 1 11 2 1 1 2 13 12... part of the non-analytical ADRV report. *** Cases that are classified... than that of non-analytical ADRV cases listed in Table 1 and...