Спутник ФКИ. Change-2. [Редактировать]

Технические характеристики

#ХарактеристикаЗначение
1Масса, кг1360

Характеристики орбиты

#ХарактеристикаЗначение
1Расчетный срок функционирования, сутки90

Экономические характеристики

#ХарактеристикаДата измеренияЗначение
1Стоимость системы , млн. долл.200

Найдено 1000 документов по запросу «Change-2». [Перейти к поиску]


Дата загрузки: 2017-03-22
Скачать документ
0.09/5
... the end, it does not change the fact that it involves... he wasn’t sure he could change even if he tried. And... that one day he would change. He had often promised to... between us, but that doesn’t change the way I felt about you..., clothes dripping. “Did you bring a change of clothes?” She shook her... pants and shirt. “You can change in the bedroom upstairs. There... years, both of them sensing a change since yesterday. When the thunder... her thoughts. Some things never change. “Take your time,” I say. I know... for almost an hour to change your mind, but when you... for this, but I will not change. Does this make me dishonest... different? Why does she sometimes change after I read? I tell the doctors... that I am invigorated by the change in temperature. Evelyn, one of..., but I am too old to change and too old to care.... Financially, of course, there’s been a change as well and it would... years. Why does Allie’s mother change her mind, especially when Allie..., I wonder, for a man to truly change? Or do character and habit...-life crisis. A sudden desire to change my life, perhaps, or maybe... nice to visit him for a change.” I reached for my wineglass. “That...



Дата загрузки: 2017-03-22
Скачать документ
0.08/5
.... The information is subject to change without notice. The information in... Management ............................................... Limitations............................................................................................ ZUSRP DISPLAY ..................................................................................... ZUSRP CHANGE ..................................................................................... ZUSRP HELP .......................................................................................... ZUVTP: Virtual tape... document, but is subject to change. Please check the Release and... contains the source (R1) devices. A change of direction in synchronization runs... the default partition, you can change the AGE attribute only. Format... Idle Y N DPAV N N HYPERPAV N N Masking Y N Config Change Management Y N Cfg Chg - Device Attributes... ZUSRP CHANGE Change the properties of a Storage Resource Pool. Format ZUSRP CHAnge SDA... remote storage system. Example Action Change the Reserve Capacity Percentage limit... 105 Messages UDCP0021E Error - cannot change attributes of default group Explanation....dd MHL2-dd.dd] ZUSRP CHAnge SDA-ccuu SRP-hhhh RCP... RDFGroup parameters 0x14 Dynamic RDFGroup change not on affected director 0x15... IP table 0x1A Dynamic RDFGroup change already in progress 0x1B Not...



Дата загрузки: 2017-03-22
Скачать документ
0/5
... interaction, apparently by inducing a conformational change in MBNL. Moreover, single molecule... U D CACGCUGCCUGCUGC CUGGAUGCCGCCUCUGCUGCUGC B C MBNL 1 2 1+2 C2 Fold change siRNA: α-MBNL1 α-MBNL2 α-actin Lane.... The histogram shows the fold change of exon 2 or exon 3 products... by an RNA-induced conformational change. Regulated skipping of Tpm1 exon... an RNA-binding–induced conformational change in MBNL1. We next asked... MBNL1 ZF1 and 2 induces a conformational change that favours interaction with PTB... the nature of the conformational change suggested by our data. The...



Дата загрузки: 2017-03-22
Скачать документ
0.14/5
... Temperature characteristic Max. relative capacitance change within 55 ... +125 °C Climatic category... Typical characteristics1) Capacitance change ∆C/C25 versus temperature T Capacitance change ∆C/C0 versus superimposed... resistance Rins versus temperature T Capacitance change ∆C/C1 versus time t 1) For more... 20 °C Capacitance at 25 °C Capacitance change Kapazität Anfangskapazität Kapazitätswert nach... described in this publication may change from time to time. The...



Дата загрузки: 2017-03-22
Скачать документ
0/5
... and reserves the right to change design and specifications without notice... and reserves the right to change design and specifications without notice... and reserves the right to change design and specifications without notice... and reserves the right to change design and specifications without notice... and reserves the right to change design and specifications without notice... and reserves the right to change design and specifications without notice...



Дата загрузки: 2017-03-22
Скачать документ
0.13/5
... publication and is subject to change without notice. G225-6832-02... service mode to repair or change modify the configuration then the... and intent are subject to change or withdrawal without notice, and... adapt in times of rapid change...Through use of an enterprise... With the rapid pace of change in storage technology, customers are...



Дата загрузки: 2017-03-22
Скачать документ
0/5
... % chng from 52 Low Change - 1 Month, % Change - 3 Months, % Change - 6 Months, % Change - 12 Months, % 210...



Дата загрузки: 2017-03-22
Скачать документ
0/5
...  the  Gross  Domestic  Product,  climate  change, transportation systems  and corporate social... & economics  SUPELEC    Monday, July 9  Climate Change and the Conditions for Industrial...  Clean Tech ‐ Using Technology to Change the World  UPM    Thursday, July...



Дата загрузки: 2017-03-22
Скачать документ
0/5
... the Detection of Atmospheric Composition Change) [13] и TCCON (Total Carbon Column... and in Radiative Forcing, Climate Change 2007: The Physical Science Ba... Intergovernmental Panel on Cli mate Change (IPCC), 2007. http://www.ipcc...



Дата загрузки: 2017-03-22
Скачать документ
0/5
... в вузах, университетах в последние 1 Strategies for change and development in higher education... Э. де Граафа и А. Колмос «Management of Change. Implementation of Problem-based and....PDF 19. Strobel J. “Management of Change. Implementation of Problem-based and...