Спутник технологический. DHFR. [Редактировать]

DHFR (DARPA High Frequency Receiver experiment) это трехюнитовый кубсат, который был разработан Utah SDL и DARPA.

Дополнительная классификация

#Наименования
1Тип орбиты - НОО
2Страна оператор(владелец) - США
3Страна производитель - США
4Тип оператора(владельца) - военные

Технические характеристики

#ХарактеристикаЗначение
1Масса, кг3

Информация об удачном запуске

#ХарактеристикаЗначение
1Космодром Мыс Канаверал
2Дата пуска2017-08-26
3Полезная нагрузка 1xORS-5
4Полезная нагрузка 1xDHFR
5Ракета-носитель 1xМинотавр 4 Орион 38

Найдено 84 документов по запросу «DHFR». [Перейти к поиску]


Дата загрузки: 2016-11-03
Скачать документ
Скачать текст
0.17/5
... ACF CD CHO-S CHO-M CHO-DHFR BalanCD™ CHO Growth A 91128 ACF... Feed 1 94119 CHO-S CHO-M CHO-DHFR • • • • BalanCD™ CHO Feed 1 91127 ACF PF / CD CHO-S CHO-M CHO-DHFR • • • • BalanCD™ CHO Feed 2 94121 ACF PF / CD CHO-S CHO-M CHO-DHFR • • • • • • • • • • • • ACF PF / CD BalanCD™ CHO... PF / CD CHO-S CHO-M CHO-DHFR BalanCD™ CHO Feed 3 94118 ACF...-S CHO-M CHO-DHFR PF / CD CHO-S CHO-M CHO-DHFR BalanCD™ CHO Feed... ACF CD CHO-S CHO-M CHO-DHFR BalanCD™ CHO Growth A 91128 ACF... Feed 1 94119 CHO-S CHO-M CHO-DHFR • • • • BalanCD™ CHO Feed 1 91127 ACF PF / CD CHO-S CHO-M CHO-DHFR • • • • BalanCD™ CHO Feed 2 94121 ACF PF / CD CHO-S CHO-M CHO-DHFR • • • • • • • • • • • • ACF PF / CD BalanCD™ CHO... PF / CD CHO-S CHO-M CHO-DHFR BalanCD™ CHO Feed 3 94118 ACF...-S CHO-M CHO-DHFR PF / CD CHO-S CHO-M CHO-DHFR BalanCD™ CHO Feed...



Дата загрузки: 2017-04-08
Скачать документ
Скачать текст
0.09/5
... amplification 5’ P5-for dhfr TTTATGATGGAACAAGTCTGC P5-1 rev dhfr ATTCATATGTACTATTTATTCTAGT P8-1 for dhps... amplification 5’ P5 for dhfr ACAAGTCTGCGACGTTTTCGATATTTATG P5 rev dhfr AGTATATACATCGCTAACAGA P8 for dhps... dhfr 16 GACGTTTTCGATATTTATGCCATATGTG 51 dhfr 51 GAAATAAAGGAGTATTACCATGGAAATGTA 59 dhfr 59 TTCACATATGTTGTAACTGCAC 108 dhfr 108 forward CAAAATGTTGTAGTTATGGGAAGAACAA 108B dhfr reverse AAAGGTTTAAATTTTTTTGGAATGCTTTCCCAG 164 dhfr 164 forward GGGAAATTAAATTACTATAAATGTTTTATT 164B dhfr 164... C-7 dhfr 16 CACATATGGCATAAATATCGAAAACGTC 51 C-7 dhfr 51 TACATTTCCATGGTAATACTCCTTTATTTC 59 C-7 dhfr 59 GTGCAGTTACAACATATGTGAA 108 C-7 dhfr 108... 108B C-7 dhfr reverse CTGGGAAAGCATTCCAAAAAAATTTAAACCTTT 164 C-7 dhfr 164 forward AATAAAACATTTATAGTAATTTAATTTCCC 164B C-7 dhfr 164 reverse... reductase– thymidylate synthase (dhfr-ts), human dihydrofolate reductase (dhfr, with or without... puromycin respectively. When using T. gondii dhfr-ts, be careful to transfect... with the positive marker human dhfr, reportedly enables the selection of... select for human dhfr, blasticidin Sdeaminase, or T. gondii dhfr-ts, we recommend... using the human dihydrofolate reductase (dhfr) gene as the selectable marker... using the human dihydrofolate reductase (dhfr) gene as the selectable marker... when using the Toxoplasma gondii dhfr gene as the selection system... with a mutation in the endogenous DHFR-TS gene, but are instead... containing either Toxoplasma gondii dhfr [2, 3] or human dhfr [4] as the gene for... markers In addition to the dhfr selectable markers described earlier, 3 other... resistant form of the T. gondii DHFR/TS gene as a selectable marker... contains the pyrimethamine-resistant T. gondii DHFR-TS gene for selection of... and the 3' UTR of P. berghei DHFR-TS. B: BamHI, E: EcoRI and H: HindIII...



Дата загрузки: 2016-10-14
Скачать документ
Скачать текст
0.26/5
... II Inhaltsverzeichnis 2.3.9.1 2.3.9.2 2.4 2.4.1 2.4.2 2.4.3 2.4.4 2.4.5 2.4.6 2.4.7 2.4.7.1 2.4.7.2 2.4.8 2.4.9 2.4.10 2.4.11 2.5 2.5.1 2.5.2 2.5.3 2.6 2.7 3 Faltungstest für DHFR der Maus ........................................................................... 38 Aggregationstest für Var1... Desoxyadenosintriphosphat dCTP Desoxycytidintriphosphat dGTP Desoxyguanosintriphosphat DHFR Dihydrofolatreduktase DLD1 D-Laktatdehydrogenase DMSO Dimethylsulfoxid... monotope Proteine wie Su9(1-112)-DHFR (Rojo et al., 1995) und Su9-CoxII(1-74)-DHFR (Herrmann et al., 1995), als... Membraninsertion von Su9(1-112)-DHFR, Su9-CoxII(1-74)-DHFR und Oxa1 ist... im Falle von Su9(1-112)-DHFR gezeigt werden konnte. Entscheidend für den...)-DHFRmut) DHFR Hel37C pFB9 (pGEM4 DHFR MRS2 (337-470)) pFB10 (pGEM4 DHFR MRS2mut... und Methoden 27 pFB9 (pGEM4 DHFR-MRS2 (337-470)) Mit Hilfe... HindIII geschnitten und in pGEM4 DHFR-Hel37C an Stelle der Hel37C-Sequenz ligiert. pFB10 (pGEM4 DHFR-MRS2mut (337-470)) Mit Hilfe... Faltungszustandes mitochondrial lokalisierter Proteine 2.3.9.1 Faltungstest für DHFR der Maus Die Bestimmung des Faltungszustandes für importierte Dihydrofolatreduktase (DHFR) erfolgte weitgehend gemäß der von... Methode. Das Fusionsprotein Su9(1-69)-DHFR bestehend aus der Präsequenz... Methotrexat Der gefaltete Zustand von DHFR kann durch das Dihydrofolatanalogon Methotrexat... Translokationsintermediate von DHFR-Fusionsproteinen herzustellen, in denen die DHFR-Domäne nicht... gut charakterisierte Fusionsprotein Su9(1-69)-DHFR sowie das Matrixprotein Yfh1 eingesetzt. Su9(1-69)-DHFR besteht aus den ersten 69... und der Dihydrofolatreduktase (DHFR). Da Su9(1-69)-DHFR unter den normalen Importbedingungen... den Import von Su9(1-69)-DHFR in ssc1-3-Mitochondrien. Mitochondrien aus... Import von gereinigtem Su9(1-69)-DHFR Vorstufenprotein (50µg/ml) bei 25... die Importeffizienz von Su9(1-69)-DHFR auf Wildtypniveau steigern kann. Auch... für den Import von Su9(1-69)-DHFR beschrieben in isolierte Mitochondrien importiert... als die von pSu9(1-69)-DHFR. Ähnlich wie von Geissler et... mit radioaktiv markiertem Su9(1-69)-DHFR inkubiert. Nach dem Import wurden... radioaktiven Vorstufenproteins Autoradiographie. Su9(1-69)-DHFR erfolgte durch SDS-Gelelektrophorese und... 3 Ergebnisse Abb. 15: Su9(1-69)-DHFR bindet an Ecm10 und an...°C mit markiertem 35 S- Su9(1-69)-DHFR inkubiert. Spur 10 zeigt 10... gezeigt, koeluierte reifes Su9(1-69)-DHFR Protein sowohl mit His-Ssc1... Imports des Vorstufenproteins Su9(1-69)-DHFR beobachtet werden (nicht gezeigt). Diese... bereits beschriebenen Vorstufenproteins Su9(1-69)-DHFR bei nicht permissiver Temperatur in... Proteins ist die Unempfindlichkeit der DHFR-Domäne gegenüber Proteaseverdau...., 1994b). Nur die korrekt gefaltete DHFR-Domäne ist unter den... ersetzen. Das Vorstufenprotein Su9(1-69)-DHFR wurde für 10 min bei 37... Menge an importiertem Su9(1-69)-DHFR im Vergleich zu Wildtyp-Mitochondrien... importierten Proteins die Unempfindlichkeit der DHFR-Domäne gegenüber Proteasen... Anteil des importierten Su9(1-69)-DHFR-Proteins proteaseempfindlich (vgl. Abb. 17... Mrs2 an den Carboxyterminus von DHFR fusioniert (Abb. 22). 3 Ergebnisse 73... radioaktiv markierten Vorstufenproteine DHFR-Mrs2(337-470) und DHFR-Mrs2(337-470..., das mit DHFR-Mrs2(337-470) beobachtet wurde. DHFR-Mrs2(337-470... verhindert die Nähe der gefalteten DHFR-Domäne zum möglichen Importsignal... und einer faltungsdefizienten Variante der DHFR eingesetzt. Dieses Fusionsprotein umfasst beide... gezeigt). erhaltenen mut Yta10(1-265)-DHFR Die Fragmente Dld1 durch von... die fragmentierte mut Yta10(1-265)-DHFR (f1) Form von wurden densitometrisch... ist ein Insertionsfaktor für Su9(1-112)-DHFR (Hell et al., 2001). Daher... sortierte Proteine wie Su9(1-112)-DHFR benötigt wird (Herrmann et...



Дата загрузки: 2017-09-24
Скачать документ
Скачать текст
0.25/5
... an uptake system Dihydrofolate reductase (DHFR, EC 1.5.1.3) is an for folates... dihydrofolate to tetrahydrofolate ition of DHFR is e¡ective because binding a¤nities... the natural substrates [2]. Enzyme new DHFR inhibitors for use against mycobacteria... examine the potential usefulness of DHFR as a drug target for , the... 2.1. Bacterial strains and plasmids The DHFR-de¢cient E. coli strain D3... (Rockville, MD). This strain contains a DHFR mutation that maps at or... library was transformed into the DHFR-de¢cient strain D3-157... system (Promega). To make the DHFR plasmid construct, p807, the pET... digested fragments of the M. avium DHFR gene were isolated in a 0.8% agarose... promoter. 2.7. Expression of recombinant M. avium DHFR The host strain BL21(DE3)plysS, containing the DHFR recombinant gene in p807, was... washed twice with cold standard DHFR assay bu¡er and the... the supernatant was assayed for DHFR activity, as described below. U 71... thrombin cleavage of recombinant DHFR Recombinant M. avium DHFR was expressed and puri... Tag fusion protein. The M. avium DHFR gene in p807 was expressed... (pH 7) and kept on ice. DHFR activity was measured at 30... [27] for the assay of DHFR from Mycobacterium phlei and consisted... from [16]). nents for 3 min. DHFR activity was corrected for NADPH... of the M. avium DHFR gene Since the DHFR gene had not been... used to complement the E. coli DHFR-de¢cient strain, D3-157... DNA constructs would contain the DHFR gene in close enough proximity... to utilize it in making DHFR to complement the de¢cient... complementation colonies, comparison with other DHFR genes indicated that revealed a 6.4 kb... the aligned sequences p502. the DHFR gene, the 38 base of... methotrexate binding sites of known DHFR Mycobacterium fol kb lated of... of several other known bacterial DHFR genes, including , and (Fig. The... codon preferences [17]. No mycobacterial DHFR se- insert. gene 3). Comparison quence... identity of to bacterial the DHFR consensus genes sequence Downloaded from... 83 bp upstream of the DHFR gene that matched thymidylate synthetase... TS gene 5P of the DHFR gene such as M. leprae eus... been sequenced downstream of the DHFR gene but no sequences have...- Fig. 4. Expression of M. avium Bank. DHFR in BL21(DE3)plysS/p807... (7 Wg) (lane 2), 3.3. Expression of recombinant DHFR DHFR HisWTag fusion protein puri¢ed... cleaved protein) and uncleaved M. avium DHFR (10 Wg) (indi- cated as... mass markers A copy of the DHFR gene was made using primers..., a putative frame was found for DHFR M. leprae open expression host BL21... size of the pro- M. avium DHFR polypeptide sequence as deter- Table 2 Expression of the DHFR recombinant gene and enzyme activity... strain E. coli a Protein (mg/ml) DHFR (10 3 U/ml) Speci¢c activity (10... have activity against mycobacterial DHFR [5]. 3.4. Activity of recombinant DHFR possible in the... this target, A unique feature of DHFR is the selectivity that is... for rational Both recombinant M. avium DHFR plasmid con- and e¡ective drug..., can be several amount of DHFR expressed as soluble protein. En... lysates zyme relative to mammalian DHFR [3]. There are from the plasmid... the many possible inhibitors of DHFR that have as yet de... been synthesized or studied [1]. Lastly, DHFR BL21(DE3)plysS was represents... ¢rst step in devel- (Table 2). DHFR present in the de¢cient...+ without the M. avium E. coli activity DHFR gene insert (Ta- ble 2). Also, in the DHFR-pro¢cient host strain BL21(DE3)plysS, DHFR-speci¢c activity was 1000fold greater... has been available concerning mycobacterial DHFR ; one other `putative' folA gene has been described. A `folA' DHFR plasmid p807 than with the...- mycobacterial 15b without the recombinant DHFR gene (Table 2). locus is listed... with 16 other infections known DHFR gene sequences in the GenBank... in antiretro- any of the DHFR sequences, nor is it homologous... : http ://www.sanger.ac.uk) DHFR se- reveals currently un¢nished... a M. tu- DNA sequence homologous with DHFR Although DHFR does not represent a `new... papers published about native mycobacterial DHFR. Al-Rubeai and Dale reported... against mycobacte- characterization of DHFR from rial DHFR [4], and Seydel and associates... synthesis of substituted 2,4- characterization of DHFR from [27], and M. smegmatis. Downloaded... [27] and M. smegmatis M. avium M. avium DHFR [28], respec- tively. These molecular... that obtained by us for DHFR (20 kDa). has been successfully... speci¢c activity of the soluble DHFR expressed by p807 with that reported for puri¢ed mycobacterial DHFR [27,28] indicates that the.... In contrast, our results with DHFR, present endogenously in M. avium extracts..., J.K. (1995) New benzylpyrimidines : inhibition of DHFR from varChem. 30, 779^787... demonstrate that the DHFR gene of 77 recombinant DHFR. It should now... to more e¤ciently screen putative DHFR inhibitors using puri¢ed en...



Дата загрузки: 2017-11-08
Скачать документ
Скачать текст
0.5/5
1 GENERAL STATEMENT OF RESEARCH ACHIEVEMENTS Oxygen-17 NMR Studies of Molecules of Biological Interest The 17 O isotope is one of the most difficult to observe by NMR spectroscopy due to extremely low absolute sensitivity compared to that of 1H(≈1.1x10-5) and the breadth of the resonances. It is, however, of great interest to use a nucleus, such as oxygen, that is located at strategic molecular sites and is directly involved in inter- and intra- molecular interactions. The objective of this research project was: (i) to introduce 17O shieldings as a new method to investigate for the first time hydration phenomena and solvation differences of the amide oxygens of the cis/trans isomers of amides, the effects of a γ-turn intramolecular hydrogen bond and β-turn structures of model peptides and peptide hormones. (publications 10a, 13a, 16a, 18a, 19a, 20a, 22a, 23a, 24a, 25a, 26a, 27a, 33a, 35a, 36a, 37a). It was demonstrated that 17 O NMR shieldings are a promising tool for studying hydration phenomena and inter- and inter-molecular hydrogen bonding effects in amides, model peptides and peptide hormones due to the large shielding range (∼100ppm) and the large and specific effect of hydrogen bonding and long range dipole-dipole interactions. This research project was initiated in the period 1981-1983 in collaboration with As. Professor J. Lauterwein, University of Lausanne, in the period 1984-1989 in collaboration with Prof. C. Sakarellos, University of Ioannina who was responsible for the synthesis of the isotope enriched 17 O compounds. Part of this research was the subject of two PhD students (Dr. C. Vakka and C. Tsanaktsidis) who completed their PhD thesis under my supervision (publications 22a, 23a, 24a, 25a, 34a). (ii) To introduce 17 O NMR shieldings as a novel tool to investigate dioxygen and carbonmonoxide binding to heme model compounds. After several unsuccessful attempts on the literature [C. Maricic et al., Nature 214, 462-466 (1967); C.S. Irving & a Lapidot, Nature 230, 224 (1971)] two signals at ∼1750 and 2500ppm were observed for the FeO 2 linkage in which the electrons are totally paired (publications 9a, 11a, 17a, 21a, 31a, 32a). This research project was initiated in collaboration with the late Dr. M. Momenteau (Institute Cure, Section de Biologie, Orsay, France) who performed the synthesis of the model compounds. Multinuclear NMR investigation of Heme Proteins and Synthetic Models Heme models have been widely used to understand the bonding of small molecules such as dioxygen and carbon monoxide to hemoproteins. The objective of this research project was to apply new NMR methods for the structural investigation of heme proteins and superstructured synthetic model compounds in solution and in the solid state. Particular emphasis has been given to: (i) 13 C cross-polarization magic-angle-spinning (CP/MRS) NMR which was reported as a novel tool for investigating whether the iron-carbon-oxygen moiety is linear or bent (publications 11b, 12b, 2 13b, 14b). Furthermore 13 C shielding of the meso carbons of several carbon monoxide hexa coordinated super structured hemoprotein models were shown to be sensitive novel method for estimating porphyrin ruffling (publications 15b, 16b). (ii) 57 Fe NMR chemical shifts of super structured heme models which have been found to be extremely sensitive to atropisomerism and deformation (ruffling) of porphyrin geometry (publications 17b, 18b, 19b) and increased shielding by more than 800 ppm with increased ruffling was observed. Furthermore, the great variation of δ(57Fe) as a function of the average displacement of the meso carbo atom (∼140 ppm / 0.1Å) demonstrates that 57Fe shielding can be used in structure refinement protocols. This project was initiated in my research group in collaboration with Dr. G. Hawkes (QMN, England) for recording the 57Fe NMR spectra and Dr. P.J. Barrie for recording CP MAS spectra due to lack of the appropriate NMR instrumentation in our University. A significant part of this research was the subject of a PhD student (Dr. C.G. Kalodimos) who completed his thesis under my supervision (publications 14b, 15b, 16b, 17b, 18b, 19b) NMR and Computational Studies of Angiotensin II, Angiotensin Converting Enzyme (ACE) and ACE Inhibitors Angiotensin II (AII), the main effector octapeptide hormone of the rennin-angiotensin system exerts a variety of actions via specific receptors designated AT 1 and AT 2 . AII has been extensively investigated in solution during the last 40 years with a variety of techniques. The results have been interpreted in terms of various models such as an α-helix, β-turn, cross-β-forms I, γ-turn, random coil side chain ring cluster etc. It is evident that several of the reported models are not consistent with each other and that there is no general consensus on the solution conformation of AII. The high resolution 3D NMR structures of the octapeptide hormone angiotensin II (AII) in aqueous solution have been obtained (...



Дата загрузки: 2017-02-23
Скачать документ
Скачать текст
Скачать перевод
Посмотреть билингву
0.11/5
... terization of point mutations in dhfr and dhps the fragment size... type Double Single mutant mutant dhfr Quadruple mutant Wild type ALLELES... Fig. 2.1.7: Genotype wise distribution of dhfr/dhps alleles among ‘Old’ and... 30 20 10 0 Wild type dhfr Mutant type Wild type dhps... type ALLELES Fig. 2.1.8: Distribution of dhfr/dhps mutant genotypes among ‘Old... vide accession numbers EU145878EU145947 for dhfr and EU149665-EU149764 for dhps.... Proportion of mutant dhfr alleles “Proportion of mutant alleles (dhfr and dhps... and mutant alleles at both dhfr and dhps loci in ‘Old... ‘New world’ isolates, at both dhfr and dhps loci but these... Ile51, Arg59 and Asn108 of dhfr and Gly437 and Glu540 of... GLURP revealed genes for pfcrt, dhfr and north-eastern states had... Ile51, Arg59 and Asn108 of dhfr of true drug failure (Fig...), six failure cases, four had dhfr polymorphism at 16, with the...



Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
0.09/5
... synthase (TSase) and dihydrofolate reductase (DHFR). The enzyme flavin-dependent thymidylate... folA encoded enzyme dihydrofolate reductase (DHFR), which synthesizes tetrahydrofolate (THF or..., and other cancers [3]. The enzyme DHFR is also targeted by drugs... trimethoprim is a bacteriostatic inhibitor of DHFR that has both Gram positive... 9 Scheme 1. Reactions catalyzedbybyTSase TSaseand and DHFR DHFR (top), Highlighted are the Scheme..., and 1O26, for TSase, DHFR, FDTS, respectively). DHFR, and FDTS, respectively). Instead... folA genes for TSase and DHFR, respectively. approximately 40% of prokaryotes... also have Comparing TSase and DHFR to FDTS shows no sequence... folA genes for TSase and DHFR, respectively. Importantly, a number of human... anthracis, Mycobacterium Comparing TSase and DHFR to FDTS shows no sequence... (Tdk) and TSase (ThyA) or DHFR (FolA) are present [16,17... (Tdk) and TSase (ThyA) or DHFR (FolA) are present [16,17... classical produced,TSase, and no DHFR is needed inon 3H]-MTHF..., thus no produced, and no DHFR is needed in FDTS incorporation... enzyme with both TSase and DHFR activities [9]. This observation together with... differences different catalytic TSase and DHFR activities [9].ofThis together withFDTS the... that of human TSase and DHFR, makes it an excellent target... this manuscript: dTMP dUMP TSase DHFR FDTS MTHF, CH2 H4 folate...



Дата загрузки: 2017-06-14
Скачать документ
Скачать текст
0.14/5
...; CRPC, castration-resistant prostate cancer; DHFR, dihydrofolate reductase; DM, double minute... amplification of the dihydrofolate reductase (DHFR) gene in the AT3000 line... sarcoma 180 cells in 1978 (9). DHFR catalyzes the reduction of dihydrofolate... analog of folic acid, inhibits DHFR activity and thus causes arrest... increased copy number of the DHFR gene. This phenomenon was observed... was observed not only with DHFR but also with the carbamoyl...). The amplification mechanism of the DHFR gene in MTX-resistant cells... co-introduced into cells. The DHFR gene is the most frequently..., the surviving cells that overproduce DHFR frequently contain several hundred to...-produce the target gene. Most DHFR-amplified cells produce up to... cycle without centromeres (17). The DHFR gene tends to be amplified...



Дата загрузки: 2017-05-20
Скачать документ
Скачать текст
0.22/5
...- trichloroethane DFT Density Functional Theory DHFR dihydrofolate reductase DHODase dihydroorotate dehydrogenase... this pathway namely dihydrofolate reductase (DHFR) and dihydropteroate synthase. Pyrimethamine and proguanil target plasmodial DHFR while the sulfur drugs target... of the drug Type-2 Inhibit DHFR by mimicking the substrate dihydrofolate...; Olliaro, 2001; Hyde , 2002) The DHFR inhibitors mode of action is... enzyme (Olliaro, 2001). The enzyme DHFR plays a vital role within the... drugs. 10 Resistance towards the DHFR and DHPS inhibitors is conferred... point mutations, occurring within the DHFR gene, have been identified as... drug binding capacity in resistant DHFR strains of P. falciparum (reviewed in... et al., 1997). In addition, DHFR and DHPS mutations seem to...



Дата загрузки: 2017-11-24
Скачать документ
Скачать текст
0.25/5
... cells COPD CSF DEB DES dhfr gene DHLP DI-I or II... amplification of 12 dihydrofolate reductase (dhfr) genes in three different experiments...-induced amplification of SV40 and dhfr sequences in SV40-transformed human... DEB DENA DES Dex DHA dhfr gene DHR123 DIC DI-I or... reported 2 C-250 Gene amplification of dhfr gene detected by MTX-selection... 98% cytotoxicity. Amplification of endogenous dhfr genes (determined by MTXselection assay... of SV40. Amplification of endogenous dhfr genes (determined by MTXselection assay...