Самолет. F-16s. [Редактировать]

Новостная лента[Найти информацию в новостях] [Найти информацию в документах]

#Новостная лента.
12016-05-09. Законодатели пытаются испугать Обаму уходом оружейных контрактов на $9 млрд в Россию.
Согласно The Wall Street Journal, группа сенаторов предупредила администрацию Обамы, что слишком долгое принятие решения относительно контрактов на поставку военных самолетов может привести к тому, что контракт получат или европейцы или россияне. Ориентировочная стоимость этих контрактов составляет $9 млрд. Покупателями выступают Катар, Кувейт и Бахрейн. Предлагаемая к продаже номенклатура состоит из истребителей F-16s, F-15 и F/A-18.
Кроме того, сенаторы отметили, что Boeing и Lockheed Martin уже заявили о возможном закрытии своих производственных линий, если у них не будет заказов. Тэги: Военные самолетыFA-18F-15F-16s

Найдено 1000 документов по запросу «F-16s». [Перейти к поиску]

Дата загрузки: 2017-09-24
Скачать документ
Скачать текст
... Strep.sp.F W/BW AGAGTTTGATCCTGGCTCAG GTACCGTCACAGTATGAACTTTCC 16S rRNA 500 .Streptococcus sp Conrads...., 2004 PlG-1 PlG-2 CATAACAATGAGAATCGC GCACCCTCGCGGGTTG 16S rRNA 1100 L. garvieae Mata et... et al., 2002 5′-TGGAACACGTTAGGGTCG-3′ 5′CTTAACTAGAAAAACTCTTGATTATTC-3′ 16S-23S rDNA 300 S.dysgalactiae Forsman... Streptococcus sp. and Enterococcus sp. 16S rRNA gene. Initially two pairs... rDNA and S. agalactiae16SrRNA and L. garvieae 16S rRNA, genes. The oligonucleotid primers... Streptococcus sp. and Enterococcus sp. 16S Rrna. A 500bp band was detected... Fig. 3. Phylogenetic tree based on 16S rRNA gene sequences constructed according...). Fig. 5. Phylogenetic tree based on 16S rRNA gene sequences constructed according...). Fig. 5. Phylogenetic tree based on 16S rRNA gene sequences constructed according...). Fig. 7. Phylogenetic tree based on 16S rRNA gene sequences constructed according... the representative strains of S. iniae 16S rRNA gene shows that Iranian... (1398bp) GQ845022 Odontesthes platensis (2010) 16S rRNA S. iniae QMA0078 (1180 bp... (398bp) FJ803994 Oreochromis niloticus (2010) 16S rRNA S. iniae S123-06 (522bp) FJ803995 O. niloticus (2010) 16S rRNA S. iniae S124-06 (522bp) FJ803996 O. niloticus (2010) 16S rRNA S. iniae S125-06 (702bp...-06 (500bp) FJ803999 O. niloticus (2010) 16S rRNA S. iniae S129-06 (688bp) FJ804000 O. niloticus (2010) 16S rRNA L. garvieae 30L (817bp) FJ151399 Aplodactylus punctatus (2008) 16S rRNA S. iniae CGX (870bp) EF126045... (501bp) GQ891547 Japanese flunder (2010) 16S rRNA S. iniae DGX01 (1500bp) HM053435 Channel cat fish (2010) 16S rRNA S. iniae YG1 (1168bp) GQ169798 Selenotoca multifasciata (2009) 16S rRNA S. iniae DGX070902 (1497bp) FJ951434 Channel cat fish (2009) 16S rRNA S. iniae CMS004 (1465bp) EU620577 Unknown fish (2008) 16S rRNA S. iniae CMS005 (1463bp) EU620578 Unknown fish (2008) 16S rRNA S. iniae CMS006 (1464bp) EU620579 Unknown fish (2008) 16S rRNA S. iniae CMS003 (1464bp) EU620580 Unknown fish (2008) 16S rRNA S. iniae CMS007 (1464bp) EU622508 Unknown fish (2008) 16S rRNA S. iniae CMS008 (1464bp) EU622509 Unknown fish (2008) 16S rRNA S. iniae CMS009 (1463bp) EU622510 Unknown fish (2008) 16S rRNA S. iniae CMS0010 (1463bp) EU622511 Unknown fish (2008) 16S rRNA S. iniae CMS0011 (1463bp) EU622512 Unknown fish (2008) 16S rRNA S. iniae CMS0012 (1463bp) EU622513 Unknown fish (2008) 16S rRNA S. iniae CMS0013 (1463bp) EU622514 Unknown fish (2008) 16S rRNA S. iniae CMS0014 (1463bp) EU622515 Unknown fish (2008) 16S rRNA L. garvieae T030817-1 (1427bp) DQ010113 Paralichthys olivaceus (2005) 16S rRNA L. garvieae FLG2 (1544bp) AF352163 Mugil cephalus (2002) 16S rRNA L. garvieae FLG4 (1544bp) AF352164... S41 (654bp) AY260834 O. mykiss (2003) 16S rRNA S. iniae ATCC29178 (1536bp) AF335572 O. mykiss (2001) 16S rRNA S. iniae ATCC29178 (1536bp) NR-025148 O. mykiss (2009) 16S rRNA L. garvieae E1 (1506bp) AB018211 Cyprinus carpio (2000) 16S rRNA L. garvieae Lg2 (1471bp) AB267897 Seriola quinqueradiata (2006) 16S rRNA L. garvieae Lg2-S(1471bp) AB267898 S. quinqueradiata (2006) 16S rRNA L. garvieae KG9502 (1471bp) AB267899 S. quinqueradiata (2006) 16S rRNA S. iniae DB39299/02 (533bp) DQ193527 Red tilapia (2005) 16S rRNA S. iniae SCCS101 (510bp) AY465111 Rachycentron canadum (2004) 16S rRNA S. iniae SCCS102 (517bp) AY480053 R. canadum (2004) 16S rRNA S. iniae SCCS103 (513bp) AY480054 R. canadum (2004) 16S rRNA S. iniae SCCS104 (506bp) AY737430 R. canadum (2005) 16S rRNA S. iniae SCCS106 (497bp) AY737432 R. canadum (2005) 16S rRNA S. iniae SCCS107 (497bp) AY737433 R. canadum (2005) 16S rRNA S. iniae SCCS108 (497bp) AY737434 R. canadum (2005) 16S rRNA S. iniae SCCS109 (497bp) AY737435 R. canadum (2005) 16S rRNA S. iniae SCCS110 (522bp) AY489403 R. canadum (2004) 16S rRNA S. iniae SCCS111 (520bp) AY489404 R. canadum (2004) 16S rRNA S. iniae JW1 (1120bp) GQ169769 Oreochromis niloticus (2009) 16S rRNA S. iniae JW3 (1130bp) GQ338313 O. niloticus (2009) 16S rRNA S. iniae JW4 (1118bp) GQ169770 O. niloticus (2009) 16S rRNA S. iniae JW6 (1120bp) GQ338314 O. niloticus (2009) 16S rRNA S. iniae JW7 (1114bp) GQ169771 O. niloticus (2009) 16S rRNA S. iniae JW9 (1141bp) GQ338315 O. niloticus (2009) 16S rRNA S. iniae ATCC29178 (534bp) AY577823...

Дата загрузки: 2017-09-25
Скачать документ
Скачать текст
... similarities after sequencing of amplified 16S rDNA fragments .. 15 viii ABSTRACT... samples. Specifically, a comparison of microbial 16S rRNA gene sequences to sequences... et al 2001). However, both 16S rRNA gene library screening and... in situ hybridization The bacteria 16S rRNA targeted oligonucleotide probes were... made glycerol and subjected to 16S rRNA gene sequence analysis. DNA... Sambrook et al (1989). The 16S rDNA genes were amplified from... MCLAB (California, USA) with the 16S rDNA sequencing primers. Polygenetic analyses Phylogenetic affiliation of each 16S rDNA sequence was initially investigated... (version 5.1, Lynnon Biosoft, Quebec, Canada). 16S rDNA sequences of phylogenetically related... were identified by sequencing of 16S rDNA. These sequences were BLAST... seven strains shared the same 16S rDNA sequence, which was 99... CBC3 the researchers compared the 16S rDNA sequence with those of....3 and 99 similarities, respectively. The 16S rDNA sequence analysis of strain... similarities after sequencing of amplified 16S rDNA fragments for isolates from... Figure 6 Phylogenetic tree based on 16S rDNA gene sequences showing the... using approximately 1,400 bp of 16S rDNA genes and the neighbor... metabolic products. Phylogenetic analysis of 16S rDNA sequence of strain CBC3... as Thiomonas perometablis CBC3. The 16S rDNA gene sequences of Thiomonas... Thiomonas perometablis as determined by 16S rDNA sequence analysis. It was... Probe Specific for Kingdom-Level 16S rRNA Sequence. Appl. Envir. Microbiol...

Дата загрузки: 2017-09-24
Скачать документ
Скачать текст
... 650.10-11 MFZ-430 16S 1820 ТО ЯМЗZF ЯМЗ-650... 650.10-31 MFZ-430 16S 1820 ТО ЯМЗZF ЯМЗ-6501... 6501.10-01 MFZ-430 16S 1820 ТО ЯМЗZF ЯМЗ-6501... 6501.10-11 MFZ-430 16S 1820 ТО ЯМЗZF ЯМЗ-6501... 6501.10-21 MFZ-430 16S 1820 ТО ЯМЗZF ЯМЗ-6501... 6501.10-31 MFZ-430 16S 1820 ТО Изделия, на которые... ТРАНСМИССИОННЫХ МАСЕЛ КОРОБКА ПЕРЕДАЧ ZF 16S 1820 ТО Для коробок передач ZF 16S 1820 ТО применять следующие трансмиссионные... масла на коробках передач ZF 16S 1820 ТО производится при наработке... сцепления: − 343151000034 с коробкой передач ZF 16S 1820 TO; − 343151000539 с КП ЯМЗ... детали КОРОБКА ПЕРЕДАЧ МОДЕЛИ ZF 16S 1820 ТО Коробка передач модели... масла на коробках передач ZF 16S 1820 ТО производится при наработке...

Дата загрузки: 2017-03-29
Скачать документ
Скачать текст
Скачать перевод
Посмотреть билингву
... and deep-sequencing of the 16S rRNA gene, we now have... the V4 region of the 16S ribosomal RNA gene to assess...) of the relatively conserved bacterial 16S ribosomal RNA gene sequence from... well as the results of 16S rRNA gene-targeted compositional analysis... communities within these samples using 16S rRNA gene-targeted amplicon pyrosequencing.... Using deep sequencing of the 16S rRNA gene of the sponge... Archaea. We showed that the 16S rRNA gene numbers of Archaea... in LMA sponges, that actinobacterial 16S rRNA gene numbers were 1-2 orders... structure will be analysed through 16S and 18S Illumina sequencing and...) and clone library analyses of 16S rRNA gene sequences. Laboratory palatability... fidelity between the partners. Combining 16S rDNA amplicon sequencing and electron... study. Illumina-based sequencing of 16S rRNA amplicons of 49 samples... investigated by PCR using specific 16S rRNA gene primers and terminal..., Queensland, Australia A sponge-specific, monophyletic 16S rRNA gene cluster is defined... a group of at least three 16S rRNA gene sequences that have... sequencing of a region of the 16S rRNA gene common to Bacteria... phototrophic symbionts or (ii) biogeography. 16S rRNA gene tag pyrosequencing data... genomic DNA and cDNA of 16S rRNA genes revealed that the...-throughput sequencing technology on the 16S rRNA gene is providing novel... 454-pyrosequencing of S. spinosulus-derived 16S rRNA gene amplicons. Prevailing bacterial... cultures were obtained. Analysis of 16S rDNA sequence data revealed that... isolated, representing 7 bacterial orders, with 16S rRNA gene sequences mostly classified... locations. A total of 51 distinct 16S rRNA amplicon libraries were constructed... existence (or otherwise) of monophyletic, 16S rRNA gene sequence clusters which... in more than 27 million 16S rRNA gene sequences and ~370...). Among these, 38% of all 16S rRNA sequence reads, and 22.... Using next-generation sequencing of 16S rRNA genes, we characterized the... the prokaryotic community based on 16S rRNA genes. Both gene specific... morphologically different 86 actinobacterial strains 16S rRNA gene were grouped into... seawater have been investigated by 16S rRNA high-throughput sequencing method... showed that, all the bacterial 16S rRNA sequences were affiliated with... nxrA, Nitrobacter nxrB), together with 16S rRNA taxonomy were analyzed synchronously... analysis further illustrated that archaeal 16S rRNA phylotypes fell into Cenarchaeum... Thaumarchaeota, while all the bacterial 16S rRNA lineages were affiliated with... (OTUs) by phylogenetic classification of 16S rRNA sequence. β-ketoacyl synthase (KS... microbiomes were here explored using 16S rDNA tag pyrosequencing. Cinachyrella specimens... cloning and sequencing of archaeal 16S rRNA and amoA genes showed...

Дата загрузки: 2017-04-23
Скачать документ
Скачать текст
... Poles had a sizable force of F-16s, but Warsaw argued that their... from 15 USAF F-15Es and F-16s, and AV-8Bs from USS... 20, escorted by 18th Squadron F-16s and supported by two Tornado...) during the following days, the F-16s carried out low-level “show..., with loadouts comprising GBU-12s, -16s, and -32s.108 The KC... by a pair of 37th Wing F-16s, which landed at 1550L while... only EPAF contributor, and Dutch F-16s made a significant contribution to NATO...—the Netherlands made available 20 F-16s and two KDC-10 tanker... the leading operator of European F-16s. Operating alongside their Dutch counterparts...–Cold War air campaign. Belgian F-16s released 271 weapons, including 32 PGMs.13 Although Norway made F-16s available for Operation Allied Force..., and Norwegian detachment of 18 F-16s, supported by an RNLAF KDC... be fixed on site, Danish F-16s were rotated between Denmark and... no-fly day, the RDAF F-16s flew every day for the... During Operation Odyssey Dawn, RDAF F-16s flew a roughly equal mix of... the Libyan conflict. The RDAF F-16s’ ability both to receive target... escort, the midlife-updated RDAF F-16s proved their versatility. With their... refueling tanker supported the Danish F-16s. Since the majority of AAR... Air Base.74 The deployed F-16s came from all of the... Arab Emirates. In particular, RNoAF F-16s had an extended cooperation with... 2008, six Belgian Air Force F-16s operated out of Kandahar, taking... the same day, four BAF F-16s conducted their first combat air... involving two aircraft. Four BAF F-16s flew one larger attack mission... anticipated the use of Belgian F-16s’ entire array of weapons. Moreover....128 After May 13, Belgian F-16s regularly conducted night missions.129... efficiently generate these numbers, Belgian F-16s were rotated between Belgium and... day, two of the six F-16s redeployed to Belgium. The following... tasking before the remaining four F-16s and the bulk of the... ceased on October 31, BAF F-16s had flown 620 sorties, including... Libye” [Night Flights by Our F-16s over Libya], May 19, 2011... pod.136 Regarding AAR, Belgian F-16s are qualified to receive fuel..., and Norwegian Experiences 295 RNLAF F-16s was kept in Afghanistan as...-to-air missiles. All RNLAF F-16s flying missions over Libya were... as a substantial threat. Thus, RNLAF F-16s relied on evasive maneuvers, the...-to-air armament, all RNLAF F-16s flying missions over Libya were... Operation Unified Protector progressed, RNLAF F-16s regularly participated in COMAO missions... defensively. When asked whether Netherlands F-16s were collecting information to prepare... Belgian, Danish, Norwegian, and USAF F-16s—the latter toward the very... an overhaul, and as RNLAF-16s had to be ferried back... was tasked with ferrying surplus F-16s to Chile. (Mulder, telephone interview... and Unified Protector Defense Expenditure F-16s Deployed PGMs Released Mission Sorties.... Since September 2008, six BAF F-16s had been operating out of... Likewise, the RNLAF deployed four F-16s to Afghanistan during the whole... reconnaissance assets meant the Dutch F-16s were worth more to the... in an EEAW context with F-16s from all five member air.... In 1999, only a few RNLAF F-16s carried targeting pods, and these... the UAE’s provision of six F-16s and six Mirages) received considerable....14 Jordan’s commitment of six F-16s in early April was, by... in the campaign both the F-16s and the Mirages would conduct... time the AFAD flew their F-16s from the UAE to the... Benghazi. The transit of the F-16s and Mirages from Al Dhafra... time in 2009, it flew F-16s that were based in nearby... the deployment.) 42 The six F-16s arrived on March 27, followed... air forces had been operating F-16s from Sigonella since the beginning... this transfer one of the F-16s overran the runway, resulting in... Regime (MTCR). As a result, the F-16s supplied to the UAE were... the Al Hakeem PGM. The F-16s also conducted strike sorties using... ongoing Operation Harmattan.32 RDAF F-16s begin operations over Libya. ITAF... Souda Bay. Belgian Air Force F-16s begin combat air patrol (CAP... Political Events March 24 RNoAF F-16s begin operations over Libya. Royal... Libye” [Night Flights by Our F-16s over Libya], May 19, 2011... Libye” [Night Flights by Our F-16s over Libya], La Défense [Defence...

Дата загрузки: 2017-05-20
Скачать документ
Скачать текст
... published primers specific to the 16S rRNA gene of Serratia symbiotica... using primers for amplifying the 16S rRNA gene and the linked 16S–23S rRNA prokaryotic genes were ... bacterial genomes include the conserved 16S rRNA gene, and as the... aphid, a positive result in the 16S rRNA screen served to demonstrate... from the aphid samples. The 16S and 23S rRNA genes are... E. coli strain O157 for the 16S and 16–23S rRNA screens... from aphid hosts The prokaryotic 16S ribosomal subunit is functionally constant... all bacterial species, whilst the 16S rRNA gene contains both highly...). As such, comparative analysis of 16S rRNA sequences allows bacterial phylogenies... the detection of expressed prokaryote 16S rRNA genes within the aphid bacteriome (Ishikawa, 1978), comparisons of 16S rRNA gene sequences amplified from...). Analysis of the primary symbiont 16S rRNA genes from other aphid..., 1993). Further comparisons of the 16S rRNA sequences amplified and cloned...., 1996) were all determined by 16S rRNA sequence analysis, as was..., other molecular methods using amplified 16S rRNA products can be employed... within the 16S rRNA gene of the endosymbionts. When 16S rRNA amplicons... primers used to amplify the 16S rRNA gene being fluorescently labelled... Buchnera is to amplify the 16S-23S rRNA genes using universal...., 2001). In most eubacteria the 16S, 23S and 5S rRNA-encoding... operon, whereas in B. aphidicola the 16S rRNA gene is no longer... used to amplify the prokaryotic 16S rRNA and the linked 16S23S... published primers specific to the 16S rRNA genes of S. symbiotica, H. defensa... the aphid templates. The 16S and 16S-23S rRNA products indicate the... of substantial product in the 16S-23S rRNA screens in eleven... curing trial, shown by bacterial 16S rRNA gene product (Figure 4.4). However... products for either the bacterial 16S-23S rRNA PCR screen or... lanes in the H. defensa and 16S-23S rRNA screens in which... of products generated in the 16S-23S rRNA and H. defensa screens... templates were positive in the 16S rRNA screen (Figure 4.5), indicating the... were also produced in the 16S-23S rRNA screen, signifying the... H. defensa, though products in the 16S-23S rRNA screen indicate the... levels of product in the 16S-23S screen (data not shown... indicates the lane in the 16S-23S rRNA screen corresponding to... only a faint band in the 16S-23S rRNA screen. This indicated... the parasitoid, although the weak 16S-23S rRNA result implies that... (2), pp. 63–69. Lane, D.J. (1991). 16S/23S rRNA sequencing. In: E. Stackebrandt... length polymorphisms of genes encoding 16S rRNA. Applied and Environmental Microbiology... endosymbiont of aphids) contains a putative 16S rRNA operon unlinked to the... of aphids) unlinked to the 16S rRNA-encoding gene. Gene. 155... relationships established by analysis of 16S rRNAs. Journal of Bacteriology. 171.... Weisburg, W.G., Barns, S.M., Pelletier, D.A. & Lane, D.J. (1991). 16S ribosomal DNA amplification for phylogenetic... 16S rRNA 16S-23S rRNA S. symbiotica 16S rRNA H. defensa 16S rRNA R. insecticola 16S rRNA PAXS 16S rRNA Rickettsia 16S rRNA Spiroplasma 16S rRNA Rickettsiella 16S... amplifying 16S rRNA, 16S-23S rRNA, S. symbiotica 16S rRNA, H. defensa 16S rRNA and R. insecticola 16S... PCR (for amplifying PAXS 16S rRNA and Rickettsiella 16S rRNA; also used... PCR (for amplifying Rickettsia 16S rRNA and Spiroplasma 16S rRNA) Time 2 minutes...

Дата загрузки: 2017-04-23
Скачать документ
Скачать текст
..., sulfate reduction rates, total CNS, 16S rRNA phylogenetic studies, catalysed reporter... shared 43% bacterial genus-level 16S rRNA-based operational taxonomic units... tree showing the affiliation of 16S rRNA sequences of cultured or.... Hydrocarbon degraders detected in the 16S rRNA gene sequence dataset from...). Here we report the microbial 16S rRNA gene diversity in Caspian... and 393,789 archaeal raw 16S rRNA gene sequences from initial... 56% and 50% of bacterial 16S rRNA gene sequences in initial... were M. semesiae and M. lacustris, with a 16S rRNA gene similarity of >98... (based on 454-pyrosequencing of 16S rRNA genes) and (C, D) archaeal taxa (based on IonTorrent-sequencing of 16S rRNA gene) in (A, C) initial core... Buffer. Sequencing of 16S rRNA genes. Bacterial 16S rRNA genes were amplified... filtering of the reads. Archaeal 16S rRNA genes were amplified with... numbers xxxxxx. Phylogenetic analysis The 16S rRNA-based phylogenetic tree was... 50% conserved regions of the 16S rRNA. Partial sequences were subsequently... for IonTorrent sequencing of archaeal 16S rRNA genes. K. Büttner is acknowledged... curves of A) bacterial 16S rRNA sequence and B) archaeal 16S rRNA gene sequences... from Caspian Sea based on 16S rRNA gene sequencing. In overlay... of 2730 sequences for bacterial 16S rRNA and 3908 sequences for archaeal 16S rRNA). Values refer to maximum... Table S4. Frequencies of archaeal 16S rRNA gene sequences retrieved from... number of quality-trimmed archaeal 16S rRNA tag sequences: 25968 for... carbon and nitrogen (TCN), and 16S rRNA phylogenetic studies according to... buffer. Sequencing of 16S rRNA genes Bacterial 16S rRNA genes were amplified... are missing. 3.5 16S rRNA phylogenetic study in NAMV 16S rRNA pyrosequencing revealed...

Дата загрузки: 2017-06-14
Скачать документ
Скачать текст
... TERCETI Diversidade Bacteriana do Gene 16s rRNA em Carvão Pirogênico... TERCETI Diversidade Bacteriana do Gene 16s rRNA em Carvão Pirogênico... Souza Diversidade bacteriana do gene 16S rRNA em carvão pirogênico... TERCETI, M. S. Diversidade bacteriana do gene 16S rRNA em carvão pirogênico... utilizando oligonucleotídeos do gene 16S rRNA para o Domínio Bacteria... bibliotecas de clones do gene 16S rRNA a partir das amostras de...; Carvão Pirogênico; Amazônia 16S; Terra Preta ABSTRACT TERCETI, M. S. Bacterial diversity of the 16S rRNA gene in pyrogenic black... reaction, using primers of the 16S rRNA gene for the Bacteria... sequenced and compared with the 16S rRNA of RDPX database. The... was segregated. Keywords: Bacterial diversity; 16S rRNA clone; Anthropogenic Dark Earth... 8 - Eletroforese dos produtos de PCR 16S rRNA e purificação ............................ 43 Figura 9 - Eletroforese... rarefação gerada de sequências 16S rRNA das bibliotecas BICAR e BITPA... rarefação gerada de sequências 16S rRNA das bibliotecas MICAR e MITPA... rarefação gerada de sequências 16S rRNA das bibliotecas MICAR e BICAR... com sequências do gene 16S rRNA relativas as bibliotecas BICAR... calculados a partir das bibliotecas de 16S rRNA de bactérias do... calculados a partir das bibliotecas de 16S rRNA de bactérias do... calculados a partir das bibliotecas de 16S rRNA de bactérias do... Adjacente BICAR Biblioteca de gene 16S rRNA do Carvão Pirogênico...ÊNICO ...................... 33 4.5 AMPLIFICAÇÃO DO GENE 16S rRNA ..................................................................... 34 4.6 PURIFICAÇÃO DO PRODUTO... INSERTO ........................................................................................................ 44 5.5 CONSTRUÇÃO DA BIBLIOTECA 16S rRNA ........................................................... 45 5.6 SEQUENCIAMENTO PARCIAL DOS... bibliotecas genômicas do gene 16S rRNA de Eubacteria. Dentro de... bibliotecas de sequências gênicas 16S rRNA , com a subsequente clonagem e sequenciamento... codifica a subunidade 16S do RNA ribossômico (rDNA 16S). O estudo das sequ... e também por sequenciamento do gene 16S rRNA desses microrganismos. Os pesquisadores.... A clonagem e o sequenciamento do gene rRNA 16S combinados com abordagens estatísticas... de clones do gene rRNA 16S, apresenta uma utilização comum em...ências de bibliotecas de rDNA 16S determinando a significância estatística...ão de sequências do gene 16S rRNA de organismos retirados diretamente... de análises do gene 16S rRNA em amostras ambientais, marinhas...), através do uso de clones 16S rRNA e comparação da diversidade bacteriana...), através do uso de clones 16S rRNA e comparação da diversidade bacteriana.... 4.5 AMPLIFICAÇÃO DO GENE 16S rRNA A amplificação do gene 16S rRNA foi realizada.... A reação de amplificação do gene 16S rRNA das amostras de solo... sequências parciais da região 16S rRNA obtidas foram comparadas com... possível a amplificação do gene 16S rRNA para todas amostras de... 8 - Eletroforese dos produtos de PCR 16S rRNA obtidos do mix de... da reação 5.5 CONSTRUÇÃO DA BIBLIOTECA 16S rRNA No total foram constru... gene que codifica para o RNAr 16S, componente da subunidade menor do...ção das 224 sequências de 16S rRNA obtidas neste trabalho para... representar sequências de genes 16S rRNA inéditas e podem indicar...á após o sequenciamento total do gene 16S rRNA, no entanto, esse estudo... base nas sequências do 16S rRNA. Alguns destes filos consistem... rarefação gerada de sequências 16S rRNA das bibliotecas BICAR e BITPA... calculados a partir das bibliotecas de 16S rRNA de bactérias do... realizar alinhamento das sequências 16S rRNA das bibliotecas BICAR e BITPA... representam o número de sequências 16s rRNA obtidas do carvão pirog..., a comparação das 242 sequências 16S rRNA obtidas para carvão pirog... rarefação gerada de sequências 16S rRNA das bibliotecas MICAR e MITPA... calculados a partir das bibliotecas de 16S rRNA de bactérias do... um alinhamento das sequências 16S rRNA dessas duas bibliotecas. Na... representam o número de sequências 16s rRNA obtidas do carvão pirog... rarefação gerada de sequências 16S rRNA das bibliotecas BICAR e MICAR... calculados a partir das bibliotecas de 16S rRNA de bactérias do... alinhamento total das sequências 16S rRNA das quatro bibliotecas foi... as sequências do gene 16S rRNA relativas as bibliotecas BICAR... com sequências do gene 16S rRNA relativas as bibliotecas BICAR... bibliotecas de clones do gene 16S rRNA a partir das amostras de... culturable aerobic heterotrophic bacteria and 16S rDNA clones derived from a deep... taxa in Libraries of 16S rRNA and 16S rRNA genes. Applied and..., W.; SCHLEIFER, K.H. Bacterial phylogeny based on 16S and 23S rRNA sequence analysis..., 1994. MACRAE, A. The use of 16S rDNA methods in soil microbial..., A.F.; STEPHEN, L.R.A; WILLIAM, B.W. Quantitative comparisons of 16S rRNA gene sequence libraries from... em sequênciamento do gene 16S rRNA. In: CONGRESSO BRASILEIRO DE..., 2004. WEISBURG, W.G.; BARNSS, S.M.; PELLETIER, D.A.; LANE, D.J. 16S ribosomal DNA amplification for phylogenetic... sequências parciais da região 16S rRNA obtidas em amostras de...

Дата загрузки: 2017-03-18
Скачать документ
Скачать текст
... A -A/C 4PK 1237 * A/C - AP DELPHI C8 2.0 16S HYPP 82-11/83 AVX10...) 11/83-93 AVX10 0800 2.2 16S A -A/C 2001 - A -A/C 6PK 1750 6PK 1450... Eng) 6PK 0730 6PK 1467 +A/C 1.9 16S GTI A +PAS A -A/C +A/C XU5M, XU5S Eng... 1387 11/02 (DW10TD Eng) 1.8 16S 11 98-10/99 +PAS...-A/C 6PK 1113 WPP AVX10 0837 x 2 2.0 16S HYPP +HYPP @ 98MM AVX10 0600... A/C -AP 6PK 0925 (FIAT Eng) A -A/C 2.0 16S 6PK 1113 (EW10J4 Eng) 6PK... - 00 6PK 0800 + PAS + A 90A +A/C 2.0 16S A - PAS + A 70A, 80A A 94-01... (XU7JB, XU7JP Eng) A 6PK 0913 1.8 16S A/C - AP 5PK 1100 (XU7JP4 Eng... 1200 110KW Eng) 6PK 0945 A -A/C A -A/C 2.0 16S (XU10J4, 6PK 0995 AVX10 0650... 1025 (TUD5, TUD5B Eng) SYNERGIE 2.0 16S A -A/C 5PK 0725 (TU5JP4 Eng) 1.5 D 6PK... - 00 +A/C (TU5JP Eng) 1.6 16S (XU10J4R Eng) 6PK 1013 + A/C 1.4 2.0 16S + PAS (SOFIM Eng... A 89-05/95 AVX10 0663 +A/C 1.8 16S (XU7JP4 Eng) AVX10 0700 1997 - 00 + MAN 2.0 16S (XU10J4R Eng) + OE BLT 91538177... + OE BLT 96056835 5PK 0737 2.0 16S 5PK 1163 (XU10J4RS Eng) + AUTO 2.0 16S 1997 - 00 1997 2000 - 6PK ... +A/C 6PK 1725 PICASSO AVX10 1125 1.8 16S, 2.0 16S 07/90-00 AVX10 1087... 1045 +PAS +A/C 2000 - (TU5JP4 Eng) 1.6 16S 6PK 1437 -PAS +A/C +A/C +PAS 06... 2.0 TURBO 1.4 (TU3JP Eng) + A 60A HYPP 2.0 16S (XU10J4R Eng) XSARA PART NO.../96-98) 1.4 D 5PK 0875 A +PAS -A/C 2.0 16S AVX10 0913 +P-V/BLT 1991 - 93 (XU10J2 Eng) 2.0 16S +V/BLT A -A/C (XU9JA Eng) 2.0 8S CIELO... - 98 (XU7JP4 Eng) 1.9 A +PAS -A/C +PAS +A/C 1.8 16S 1.6 (RENAULT Eng) 1970 - 90 AVX10... A+STD COOL AVX10 0900 (16N,16S Eng) 1969-71 A AVX10 1050... A AVX13 1275 1.6 PAS AVX13 1175 (16S,16SH Eng) (A428II Eng) NISSAN... PAS VPP A 80-07/83 1.6 16S(TU5JP4 Eng) 1998- A AVX10 0850... A PAS-A/C 1.8 (XU7JB Eng) A-A/C VPP +PAS-A/C 1.6 16S 1.1 1999- (TU1M,TU1JP Eng) +PAS... A/C-AP 4PK 0837 A AVX10 0787 2.0 16S F AVX10 1200 (XU10J4 Eng) VPP...-97 (XU7JP Eng) 6PK 1100 2.0 16S 4PK 0963 (XU10J4R Eng) 4PK 1213 2.0 16S AVX10 0613 (XU10J4RS Eng) 19961996....NO.8239301 07/98-00 +A/C 1.8 16S AVX10 0887 1962-75 F+DYN... Eng) 1987-94 A AVX10 0713 2.0 16S 1.6,1.9 1987-92 A-PAS 4PK 0700... (XU5JP Eng) +PAS 4PK 0963 2.0 16S A/C-AP 4PK 0837 (EW10J4 Eng... Eng) +PAS-A/C +A VALEO A11V123(70A) 2.2 16S 6PK 1063 +A VALEO A13V151, MITSUBISHI(90A) 1.9 1992-94 (XU9J2C Eng) 1.9 16S 1987-92 (XU9J4 Eng)(MOD... 0550 +A/C (EW7J4 Eng) (XU52C,XU92C, 1.6 1.8 16S 6PK 1700 A-A/C (XU7JP4 Eng) D/Eng... AVX10 0650 PAS AVX10 1050 2.0 16S F AVX10 1125 (XU10J4R Eng) PAS...-97 (ZPJ,ZPJ4 Eng) 806 2.0 16S -A/C 6PK 1163 (EW10J4 Eng) +A/C 6PK... 06/95-00 4PK 0637 A 2.0 16S 6PK 1100 5PK 1450 1997... A AVX10 0913 (4C90,4CT90 Eng) 2.2 16S(EW12J4 Eng) 2000- A+A/C 6PK 1700... 1100 K7M.790 66KW Eng) 2.0 16S AVX10 0625 5PK 1100 3PK 0825 2.0 AVX10 0687 DYN A-A/C PAS-A/C 1.8 16S AVX10 0687 F A (K7M.702, K7M.703, 1.6 16S A AVX10 0650 AVX10 0675 1999... 1137 +A/C 6PK 1637 5PK 1750 2.0 16S(F4R Eng) 2000- A+A/C 5PK 1450...) +A/C 6PK 1637 AVX13 0725 SPIDER 2.0 16S(F7R Eng) 1996- A A/C-AP AVX13...-95 A AVX10 1000 A AVX10 1250 2.0 16S (F4R Eng) 2001- A 6PK 1800...) R30 YEAR PAS (J7T Eng) 1.9 D 2.0 16S,2.5 20S +P-V/BLT 5PK +PAS-A/C R25...) +A/C 4PK 1185 1.6 PAS 3PK 0850 (16S 16SH Eng) A-A/C 4PK 0925 +A/C 4PK... AVX10 0887 +PAS AVX10 0925 (16S,16SH Eng) 5PK 1687 PAS...

Дата загрузки: 2017-04-09
Скачать документ
Скачать текст
..., now for example, take the F-16s. This happened with the three.... If that had not happened, F-16s would not have happened. We... from that. You mentioned the F-16s. When the news first broke... Americans would try to sell F-16s to Pakistan, the Indian Prime... offer to India: not just F-16s but also F-18s. And there... INDIA’S FOREIGN RELATIONS - 2005 of F-16s to Pakistan. You may be... to the particular matter of F-16s and F-18s. But there is... : You are sticking to the F-16s, but I am talking about the... arming our proliferating neighbour with F-16s but helping pay for them... community by selling and receiving F-16s at this time of our... far as the issue of F-16s is concerned, I think India’s position... you discuss the sale of F-16s to both India and Pakistan... question of arms sale including F-16s did come up. As I have... our views with regard to F-16s are well known.Now, with...: “The U.S. has decided to give F-16s to Pakistan. As far as... the issue of supply of F-16s to Pakistan? Answer: Well, the...