Самолет. F-16s. [Редактировать]

Новостная лента[Найти информацию в новостях] [Найти информацию в документах]

#Новостная лента.
12016-05-09. Законодатели пытаются испугать Обаму уходом оружейных контрактов на $9 млрд в Россию.
Согласно The Wall Street Journal, группа сенаторов предупредила администрацию Обамы, что слишком долгое принятие решения относительно контрактов на поставку военных самолетов может привести к тому, что контракт получат или европейцы или россияне. Ориентировочная стоимость этих контрактов составляет $9 млрд. Покупателями выступают Катар, Кувейт и Бахрейн. Предлагаемая к продаже номенклатура состоит из истребителей F-16s, F-15 и F/A-18.
Кроме того, сенаторы отметили, что Boeing и Lockheed Martin уже заявили о возможном закрытии своих производственных линий, если у них не будет заказов. Тэги: Военные самолетыFA-18F-15F-16s

Найдено 1000 документов по запросу «F-16s». [Перейти к поиску]


Дата загрузки: 2017-12-26
Скачать документ
Скачать текст
0.15/5
... XIX 16.3 LIBRERIE DI CLONI 16S DNA/CDNA .................................................................................................. 161 16.3.1 Principio... che codifica per la subunità 16S dell’RNA ribosomale); tuttavia, questa... la T-RFLP applicata al gene 16S rRNA di Batteri o Archaea o Terminal... regione intergenica compresa tra i geni 16S e 23S sull’operone rRNA (nota... specie batteriche rispetto al gene 16S rDNA (Daffonchio et al., 2003... 10 mM) - 0,5 µl del primer forward “16S-1392F” (5’ -GYACACACCGCCCGT- 3’) alla concentrazione di... S. (2003) Nature of polymorphisms in 16S - 23S rRNA gene intergenic transcribed... sull’analisi del gene ribosomale 16S rDNA recante informazioni sulla tassonomia... di librerie di cloni del 16S rRNA, rimangono le tecniche pi... a regioni specifiche dell’RNA ribosomiale 16S o 23S (Amann et al., 1995... accuratezza. 16.3 LIBRERIE DI CLONI 16S DNA/CDNA Una delle tecniche... della sub-unità del ribosoma 16S, importante marker evolutivo e biologico. La... delle diversità delle sequenze del 16S DNA (o RNA) si propone fondamentale....3.1 Principio Sequenze parziali o totali del 16S DNA (o RNA) possono essere amplificate... ottenute tramite l’amplificazione del frammento 16S a partire da 161 campioni di... ottenute tramite l’amplificazione del frammento 16S a partire dall’ RNA, permetteranno di... di una libreria di cloni 16S DNA/cDNA per lo studio... min a 72°C), la porzione del 16S del DNA totale della comunit... of marine bacterioplankton determined by 16S rRNA gene clone libraries and... length polymorphisms of genes encoding 16S rRNA. Appl. Environ. Microbiol.. 63... invece geni plastidiali, quali il 16S rDNA, si ottengono informazioni sulla...., 2007b). I primers universali per il 16S rDNA sono abbastanza specifici da... Zeidner et al., 2003 18S 16S psbA 27.5.2.4 Clonaggio e minipreparazione Il...: Insights from comparison of two 16S rRNA clone libraries constructed from... S.W., DEVEREUX R., STAHL D.A. (1990) - Combination of 16S rRNA-targeted oligonucleotide probes with...



Дата загрузки: 2017-12-26
Скачать документ
Скачать текст
0.16/5
..., с помощью метода гибридизации in situ с 16S рРНК169 специфичными олигонуклеотидными зондами, меченными... разнообразия клонированных фрагментов генов 16S рРНК (филотипов), представленных в 16S рДНК амплификатах суммарной... клеток исследуемых бактерий. Последовательность генов 16S рРНК предполагаемой магнитотактической бактерии была... экологических ниш с помощью секвенирования гена 16S рРНК Мынбаева Марьяна Жандосовна (Казахстан... бактерий, основанная на последовательности нуклеотидов 16S рРНК, позволяет на основании сравнения первичной структуры части гена 16S рРНК с известными структурами из GenBank... к различным таксономическим группам и видам. Ген 16S рРНК имеет как высококонсервативные, так... взаимоотношений внутри бактериальных сообществ. Ген 16S рРНК содержит ~1550 п.н. Значительную часть... экологических ниш, с помощью секвенирования гена 16S рРНК. Объектом исследований были 50... поиска соответствий полученной нуклеотидной последовательности 16S rRNA с нуклеотидными последовательностями GenBank получены... на сравнении нуклеотидных последовательностей генов 16S РНК в накопительных культурах были обнаружены... По сходству в последовательности нуклеотидов в гене 16S рДНК и составу клеточных жирных кислот... имеющиеся различия в нуклеотидных последовательностях гена 16S рДНК, а также в фенотипических признаках, таких... 15°С. Определена нуклеотидная последовательность гена 16S рРНК и показано, что она практически идентична последовательности 16S рРНК Aliivibrio logei и A. salmonicida, но..., A. fischeri, и KCh1 по нуклеотидной последовательности 16S рРНК и гена luxB, показывает близость... проведено по результатам сравнения последовательностей 16S рДНК, а также прямого бактериального профилирования... были идентифицированы как Bacillus subtilis 16S, Brenneria salcis 38Ph, Stenotrophomonas sp... показано, что штамм Bacillus subtilis 16S не обладает антагонистической активностью по... и по отношению к штамму Bacillus subtilis 16S. Результаты работы указывают на то...



Дата загрузки: 2017-12-26
Скачать документ
Скачать текст
0.06/5
... on primers that amplify the 16S rRNA gene. Amplification is achieved... RAPD is that it avoids 16S primers; this is advantageous as 16S primers may not bind with ... of a microbial community. A problem with 16S rDNA based techniques is that... with comparing samples when the 16S bias is not important to.... Like RAPD, AFLP avoids the 16S rRNA gene and presents a less... primers (most commonly from the 16S gene), and the PCR products... used in addition to the 16S TRFLP to provide an increased... the PCR amplification of the 16S rRNA gene, RISA is subject... target specific genes other than 16S rRNA, which may be important... MALDI can be used for 16s bacterial DNA, this might mean... length polymorphisms of genes encoding 16s rRNA. Applied Environmental Microbiology. 1997...



Дата загрузки: 2017-12-26
Скачать документ
Скачать текст
0.21/5
... In sequence C, fields 16R and 16S may not be the only.... If both fields 16R and 16S are present, then at least... subsequence B1, fields 16R and 16S may not be the only.... If both fields 16R and 16S are present, then at least... subsequence B2, fields 16R and 16S may not be the only.... If both fields 16R and 16S are present, then at least.... In sequence C, fields 16R and 16S may not be the only.... If both fields 16R and 16S are present, then at least... in ISO 15022 MTs field 16S in ISO 15022 MTs. T93...



Дата загрузки: 2017-03-29
Скачать документ
Скачать текст
Скачать перевод
Посмотреть билингву
0.24/5
... and deep-sequencing of the 16S rRNA gene, we now have... the V4 region of the 16S ribosomal RNA gene to assess...) of the relatively conserved bacterial 16S ribosomal RNA gene sequence from... well as the results of 16S rRNA gene-targeted compositional analysis... communities within these samples using 16S rRNA gene-targeted amplicon pyrosequencing.... Using deep sequencing of the 16S rRNA gene of the sponge... Archaea. We showed that the 16S rRNA gene numbers of Archaea... in LMA sponges, that actinobacterial 16S rRNA gene numbers were 1-2 orders... structure will be analysed through 16S and 18S Illumina sequencing and...) and clone library analyses of 16S rRNA gene sequences. Laboratory palatability... fidelity between the partners. Combining 16S rDNA amplicon sequencing and electron... study. Illumina-based sequencing of 16S rRNA amplicons of 49 samples... investigated by PCR using specific 16S rRNA gene primers and terminal..., Queensland, Australia A sponge-specific, monophyletic 16S rRNA gene cluster is defined... a group of at least three 16S rRNA gene sequences that have... sequencing of a region of the 16S rRNA gene common to Bacteria... phototrophic symbionts or (ii) biogeography. 16S rRNA gene tag pyrosequencing data... genomic DNA and cDNA of 16S rRNA genes revealed that the...-throughput sequencing technology on the 16S rRNA gene is providing novel... 454-pyrosequencing of S. spinosulus-derived 16S rRNA gene amplicons. Prevailing bacterial... cultures were obtained. Analysis of 16S rDNA sequence data revealed that... isolated, representing 7 bacterial orders, with 16S rRNA gene sequences mostly classified... locations. A total of 51 distinct 16S rRNA amplicon libraries were constructed... existence (or otherwise) of monophyletic, 16S rRNA gene sequence clusters which... in more than 27 million 16S rRNA gene sequences and ~370...). Among these, 38% of all 16S rRNA sequence reads, and 22.... Using next-generation sequencing of 16S rRNA genes, we characterized the... the prokaryotic community based on 16S rRNA genes. Both gene specific... morphologically different 86 actinobacterial strains 16S rRNA gene were grouped into... seawater have been investigated by 16S rRNA high-throughput sequencing method... showed that, all the bacterial 16S rRNA sequences were affiliated with... nxrA, Nitrobacter nxrB), together with 16S rRNA taxonomy were analyzed synchronously... analysis further illustrated that archaeal 16S rRNA phylotypes fell into Cenarchaeum... Thaumarchaeota, while all the bacterial 16S rRNA lineages were affiliated with... (OTUs) by phylogenetic classification of 16S rRNA sequence. β-ketoacyl synthase (KS... microbiomes were here explored using 16S rDNA tag pyrosequencing. Cinachyrella specimens... cloning and sequencing of archaeal 16S rRNA and amoA genes showed...



Дата загрузки: 2017-12-10
Скачать документ
Скачать текст
0.35/5
... similar PAC degrading capabilities and 16S rRNA signatures are found in... tree showing phylogenetic relationships of 16S 54 rRNA sequences cloned from... (DGGE) of PCR-amplified 74 16S rRNA genes from anthracene (A)-, phenanthrene... showing the phylogenetic relationship of 16S 77 rRNA sequences cloned from... phylogenetic relationship of the 100 16S rRNA sequences from PAH-degrading... percentage sequence homology of the 16S rRNA 51 Table 2.2 clone library... days enrichment with anthracene. Table 3.2 16S rRNA clone library of the... functional genes and the corresponding 16S rRNA from degradative populations can... hydrogen-degrading bacteria Generation of 16S rRNA clone libraries. Clone libraries... hydrogen-degrading bacteria for complete 16S rRNA sequence analysis. The sequence... percentage sequence homology of the 16S rRNA clone library isolated from... percentage sequence homology of the 16S rRNA clone library isolated from... percentage sequence homology of the 16S rRNA clone library isolated from... crystal and acetone enrichments. All 16S rRNA sequences were aligned and... 2.7). Phylogenetic analysis demonstrated that the 16S rRNA gene clones from the... Actinobacteria (phenanthrene clone 3). All the 16S rRNA gene clones from acetone... tree showing phylogenetic relationships of 16S rRNA sequences cloned from the... samples from each culture using 16S rRNA polymerase chain reaction-denaturing... communities within each enrichment using 16S rRNA sequence data. Our findings... using a AutoChemiSystem (UVP). Generation of 16S rRNA clone libraries Clone libraries... The sequences obtained from the 16S rRNA sequence analysis were submitted... electrophoresis (DGGE) of PCR-amplified 16S rRNA genes from anthracene (A)-, phenanthrene... clones were selected for complete 16S rRNA sequence analysis. The sequence... as Pseudomonas sp. (Table 3.3). Table 3.1: 16S rRNA clone library of the.../PHE/DBT degradative communities. All 16S rRNA sequences were aligned and... 3.3). Phylogenetic analysis demonstrated that the 16S rRNA gene clones from the... the Actinobacteria (phenanthrene clone 3). The 16S rRNA gene clones from the... 4.0 showing the phylogenetic relationship of 16S rRNA sequences cloned from the...-degrading communities demonstrated that the 16S rRNA gene clones from the... genes. Characterisation of a gene encoding 16S ribosomal RNA. Nucleic Acids Res... for PAHdioxygenases and the corresponding 16S rRNA from PAH-degrading species... partially inconsistent with the corresponding 16S rRNA tree. The findings suggest... functional genes and the corresponding 16S rRNA from degradative populations can... PAH dioxygenases and the corresponding 16S rRNA from PAH-degrading species... Clustal X (Thompson et al, 1997). 16S rRNA aligned sequences were equivalent...; this is consistent with the 16S rRNA-based analysis. Major incongruencies... for the α, β, and γ-Proteobacteria. The 16S rRNA tree indicates that the... closely related. Incongruence between the 16S rRNA phylogeny and α subunit phylogeny... the phylogenetic relationship of the 16S rRNA sequences from PAH-degrading... within groups A to I from the 16S rRNA phylogeny (figure 4.2). Incongruence between the 16S rRNA phylogeny and α subunit phylogeny... on figure 4.1). Incongruence between the 16S rRNA phylogeny and α subunit phylogeny... (AAT37557) (figure 4.1). Incongruence between the 16S rRNA phylogeny and α subunit phylogeny... figure 4.1) which is consistent with 16S rRNA-based analysis. However, Terrabacter.... HH2 (Actinobacteria group II). The 16S rRNA-based analysis clustered Mycobacteria... II. However, contradictory to the 16S rRNA analysis, the α subunit phylogeny... conflicts between the α subunit - and 16S rRNA-based analyses is lateral... topology when compared to the 16S rRNA-based phylogeny particularly within..., which is consistent with the 16S rRNAbased analysis (see figure 4.1). This..., which is inconsistent with the 16S rRNA-based phylogeny (figure 4.1 and... and P. van Berkum. 2004. Corresponding 16S rRNA gene segments in Rhizobiaceae... (2002) investigated the diversity of 16S rRNA and naphthalene dioxygenase genes... and relative levels of different 16S rRNA gene amplicons both qualitatively... perform a community analysis. However, in 16S rRNA gene diversity studies of... α subunit of PAH-dioxygenases with a 16S rRNA sequenced-based phylogeny, which... and Proteobacteria (as defined by 16S rRNA sequence analysis). There seemed... the α subunit phylogeny with the 16S rRNA phylogeny indicates that there..., C. and E. L. Madsen. 2002. Diversity of 16S rDNA and naphthalene dioxygenase genes... genes. Characterisation of a gene encoding 16S ribosomal RNA. Nucleic Acids Res... and P. van Berkum. 2004. Corresponding 16S rRNA gene segments in Rhizobiaceae... amplification of naphthalene-catabolic and 16S rRNA gene sequences from indigenous... reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59... reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59.... Ward D. M., R. Weller and M. M. Bateson. 1990. 16S rRNA sequences reveal numerous uncultured...



Дата загрузки: 2017-12-10
Скачать документ
Скачать текст
0.14/5
... uma abordagem molecular (genes COI, 16S, H3 e 18S) e morfológica com... (H2) (5’AGATAGAAACCAACCTGG-3’) (Crandall & Fitzpatrick 1996) e 16S-L2 (5’TGCCTGTTTATCAAAAACAT-3’) (Schubart et al. 2002) para o gene 16S rRNA, H3af (5’-ATGGCTCGTACCAAGCAGACVGC-3’) e H3ar (5’- ATATCCTTRGGCATRATRGTGAC... (Thermo Scientific). Para os genes 16S e H3 foram adicionados 2 μl de albumina... KP179012 Ashelby et al., 2012 (16S) Palaemon affinis H. Milne Edwards, 1837... KP179018 Ashelby et al., 2012 (16S) Palaemon carinicauda (Holthuis, 1950) Mai... 1. Continuação. Tombo em Coleção GenBank 16S GenBank H3 GenBank 18S OUMNH... KP179030 Carvalho et al., 2014b (16S) Palaemon gravieri (Yu, 1930) Mar... KC515058 Kou et al., 2013 (16S. H3 e 18S) Palaemon hancocki Holthuis... KP179031 Carvalho et al., 2014b (16S) Táxon Localidade Palaemon concinnus Dana... et al., 2014b (16S) Ashelby et al., 2012 (16S) Carvalho (2014) 34... KP179033 Carvalho et al., 2014b (16S) Palaemon kadiakensis (Rathbun, 1902) Convent... KP179034 Carvalho et al., 2014b (16S) Palaemon lindsayi (Villalobos Figueroa & H.H.Jr...ção. Carvalho (2014) Tabela 1. Continuação. GenBank 16S GenBank H3 GenBank 18S UF...., 2014b (16S) Ashelby et al., 2012 (16S) Carvalho et al., 2014b (16S) 36... KP179051 Ashelby et al., 2012 (16S) Palaemon peringueyi (Stebbing, 1915) Estu... KP179027 Carvalho et al., 2014b (16S) Palaemon ritteri Holmes, 1895 Bah... KP179053 Carvalho et al., 2014b (16S) Palaemon semmelinkii (De Man, 1881... et al., 2012 (16S) Ashelby et al., 2012 (16S, H3) Táxon Localidade... 1. Continuação. Tombo em Coleção GenBank 16S GenBank H3 GenBank 18S Refer... KP179065 Carvalho et al., 2014b (16S) Rio Salado, Zaragoza, México CNCR... et al., 2012 (16S) Kou et al., 2013 (16S. H3 e 18S) Carvalho... Localidade Tombo em Coleção GenBank 16S GenBank H3 GenBank 18S Refer... NO Ashelby et al., 2012 (16S, H3) Leptopalaemon glabrus (Bruce, 1993... EU249463 Page et al., 2008 (16S. H3 e 18S) Macrobrachium americanum Spence... JQ805861 JQ805843 Rossi & Mantelatto, 2013 (16S. H3 e 18S) Macrobrachium hainanense (Parisi... FM986565 Wowor et al., 2009 (16S. H3 e 18S) Macrobrachium jaroense (Cowles... FM986569 Wowor et al., 2009 (16S. H3 e 18S) Macrobrachium lar (Fabricius... 1. Continuação. Tombo em Coleção GenBank 16S GenBank H3 GenBank 18S Refer... KP179011 Carvalho et al., 2013 (16S) Pseudopalaemon chryseus Kensley & Walker, 1982...ção de nucleotídeos TIM2+Γ+I para 16S, TrNef+Γ+I para H3 e TPM2+Γ+I para...ção 6) e em combinação de dois genes (16S+H3, 16S+18S, H3+18S) (configura... verossimilhança (bootstrap), respectivamente. a: apenas 16S; b: apenas H3; c: 16S e H3. DLA: desenvolvimento larval...ências parciais dos genes mitocondriais 16S rRNA (~550 pb) e citocromo c oxidase... Localidade Tombo em Coleção GenBank 16S GenBank COI GenBank H3 Refer... NO NO Pileggi & Mantelatto, 2010 (16S) Palaemon argentinus (Nobili, 1901) 4 Mar... JN674397 Ashelby et al., 2012 (16S, H3) Palaemon argentinus (Nobili, 1901... NO Cuesta et al., 2012 (16S) Palaemon carteri (Gordon, 1935) 1 Santa... KP179074 Carvalho et al., 2014 (16S) Palaemon carteri (Gordon, 1935) 2 Mocambo... NO Carvalho et al. 2014 (16S) Palaemon carteri (Gordon, 1935) 3 Jequiri... KP179193 Carvalho et al., 2014 (16S) Palaemon carteri (Gordon, 1935) 4 Porto... GQ227820 NO NO Baeza, 2010 (16S) Palaemon floridanus Chace, 1942 3 Atl... KP179075 Carvalho et al., 2014 (16S) Cascades Fourgassie, leste de Cayenne... Localidade Tombo em Coleção GenBank 16S GenBank COI GenBank H3 Refer... KP179198 Carvalho et al., 2014 (16S) KF923729 NO KP179200 Carvalho et al., 2014 (16S) KF923728 NO KP179199 Carvalho et al., 2014 (16S) Palaemon ivonicus (Holthuis, 1950) 2 Rio... KP179203 Carvalho et al., 2014 (16S) Carvalho (2014) 115 115 Carvalho... Localidade Tombo em Coleção GenBank 16S GenBank COI GenBank H3 Palaemon... Localidade Tombo em Coleção GenBank 16S GenBank COI GenBank H3 Palaemon... Localidade Tombo em Coleção GenBank 16S GenBank COI GenBank H3 Palaemon... 1. Continuação. Tombo em Coleção GenBank 16S GenBank COI GenBank H3 Rio... JN674364 Ashelby et al., 2012 (16S, H3) 1 Baía Wafer, Puntarenas, Costa... de extração, amplificação dos genes 16S rRNA e H3, purificação, sequenciamento e alinhamento... substituição utilizados para os genes 16S rRNA, histona H3 e citocromo c oxidase subunidade I (COI). 16S rRNA Histona H3 COI TIM2... média 0,007 (± 0,001689) para o gene 16S, 0,02 (± 0,002946) para COI e 0,0015... de 0,1900 (± 0,0134) para o gene 16S, 0,2305 (± 0,0169) para o COI e 0,1294... entre P. pandaliformis e P. carteri nos genes 16S e COI, com médias de 0,1354... de 0,0312 (± 0,0053) no gene 16S, 0,0162 (± 0,0044) no COI (considerando... foi de 0,0261 (± 0,0045) para 16S, 0,0191 (± 0,0026) para COI e 0,0014... uma matriz concatenada dos genes 16S, COI e H3, considerando a divergência... não corrigida (distância p) dos genes 16S rRNA, citocromo c oxidase subunidade 1 e histona.... * Inclui espécimes de P. floridanus. 16S Erro Padrão 0,0021 Média - COI... linhagens, tanto nos genes mitocondriais 16S e COI quanto no nuclear H3..., D.L. 2000. Use of the mitochondrial 16S rRNA gene for phylogenetic and...



Дата загрузки: 2017-04-23
Скачать документ
Скачать текст
0.05/5
... Poles had a sizable force of F-16s, but Warsaw argued that their... from 15 USAF F-15Es and F-16s, and AV-8Bs from USS... 20, escorted by 18th Squadron F-16s and supported by two Tornado...) during the following days, the F-16s carried out low-level “show..., with loadouts comprising GBU-12s, -16s, and -32s.108 The KC... by a pair of 37th Wing F-16s, which landed at 1550L while... only EPAF contributor, and Dutch F-16s made a significant contribution to NATO...—the Netherlands made available 20 F-16s and two KDC-10 tanker... the leading operator of European F-16s. Operating alongside their Dutch counterparts...–Cold War air campaign. Belgian F-16s released 271 weapons, including 32 PGMs.13 Although Norway made F-16s available for Operation Allied Force..., and Norwegian detachment of 18 F-16s, supported by an RNLAF KDC... be fixed on site, Danish F-16s were rotated between Denmark and... no-fly day, the RDAF F-16s flew every day for the... During Operation Odyssey Dawn, RDAF F-16s flew a roughly equal mix of... the Libyan conflict. The RDAF F-16s’ ability both to receive target... escort, the midlife-updated RDAF F-16s proved their versatility. With their... refueling tanker supported the Danish F-16s. Since the majority of AAR... Air Base.74 The deployed F-16s came from all of the... Arab Emirates. In particular, RNoAF F-16s had an extended cooperation with... 2008, six Belgian Air Force F-16s operated out of Kandahar, taking... the same day, four BAF F-16s conducted their first combat air... involving two aircraft. Four BAF F-16s flew one larger attack mission... anticipated the use of Belgian F-16s’ entire array of weapons. Moreover....128 After May 13, Belgian F-16s regularly conducted night missions.129... efficiently generate these numbers, Belgian F-16s were rotated between Belgium and... day, two of the six F-16s redeployed to Belgium. The following... tasking before the remaining four F-16s and the bulk of the... ceased on October 31, BAF F-16s had flown 620 sorties, including... Libye” [Night Flights by Our F-16s over Libya], May 19, 2011... pod.136 Regarding AAR, Belgian F-16s are qualified to receive fuel..., and Norwegian Experiences 295 RNLAF F-16s was kept in Afghanistan as...-to-air missiles. All RNLAF F-16s flying missions over Libya were... as a substantial threat. Thus, RNLAF F-16s relied on evasive maneuvers, the...-to-air armament, all RNLAF F-16s flying missions over Libya were... Operation Unified Protector progressed, RNLAF F-16s regularly participated in COMAO missions... defensively. When asked whether Netherlands F-16s were collecting information to prepare... Belgian, Danish, Norwegian, and USAF F-16s—the latter toward the very... an overhaul, and as RNLAF-16s had to be ferried back... was tasked with ferrying surplus F-16s to Chile. (Mulder, telephone interview... and Unified Protector Defense Expenditure F-16s Deployed PGMs Released Mission Sorties.... Since September 2008, six BAF F-16s had been operating out of... Likewise, the RNLAF deployed four F-16s to Afghanistan during the whole... reconnaissance assets meant the Dutch F-16s were worth more to the... in an EEAW context with F-16s from all five member air.... In 1999, only a few RNLAF F-16s carried targeting pods, and these... the UAE’s provision of six F-16s and six Mirages) received considerable....14 Jordan’s commitment of six F-16s in early April was, by... in the campaign both the F-16s and the Mirages would conduct... time the AFAD flew their F-16s from the UAE to the... Benghazi. The transit of the F-16s and Mirages from Al Dhafra... time in 2009, it flew F-16s that were based in nearby... the deployment.) 42 The six F-16s arrived on March 27, followed... air forces had been operating F-16s from Sigonella since the beginning... this transfer one of the F-16s overran the runway, resulting in... Regime (MTCR). As a result, the F-16s supplied to the UAE were... the Al Hakeem PGM. The F-16s also conducted strike sorties using... ongoing Operation Harmattan.32 RDAF F-16s begin operations over Libya. ITAF... Souda Bay. Belgian Air Force F-16s begin combat air patrol (CAP... Political Events March 24 RNoAF F-16s begin operations over Libya. Royal... Libye” [Night Flights by Our F-16s over Libya], May 19, 2011... Libye” [Night Flights by Our F-16s over Libya], La Défense [Defence...



Дата загрузки: 2017-05-20
Скачать документ
Скачать текст
0.15/5
... published primers specific to the 16S rRNA gene of Serratia symbiotica... using primers for amplifying the 16S rRNA gene and the linked 16S–23S rRNA prokaryotic genes were ... bacterial genomes include the conserved 16S rRNA gene, and as the... aphid, a positive result in the 16S rRNA screen served to demonstrate... from the aphid samples. The 16S and 23S rRNA genes are... E. coli strain O157 for the 16S and 16–23S rRNA screens... from aphid hosts The prokaryotic 16S ribosomal subunit is functionally constant... all bacterial species, whilst the 16S rRNA gene contains both highly...). As such, comparative analysis of 16S rRNA sequences allows bacterial phylogenies... the detection of expressed prokaryote 16S rRNA genes within the aphid bacteriome (Ishikawa, 1978), comparisons of 16S rRNA gene sequences amplified from...). Analysis of the primary symbiont 16S rRNA genes from other aphid..., 1993). Further comparisons of the 16S rRNA sequences amplified and cloned...., 1996) were all determined by 16S rRNA sequence analysis, as was..., other molecular methods using amplified 16S rRNA products can be employed... within the 16S rRNA gene of the endosymbionts. When 16S rRNA amplicons... primers used to amplify the 16S rRNA gene being fluorescently labelled... Buchnera is to amplify the 16S-23S rRNA genes using universal...., 2001). In most eubacteria the 16S, 23S and 5S rRNA-encoding... operon, whereas in B. aphidicola the 16S rRNA gene is no longer... used to amplify the prokaryotic 16S rRNA and the linked 16S23S... published primers specific to the 16S rRNA genes of S. symbiotica, H. defensa... the aphid templates. The 16S and 16S-23S rRNA products indicate the... of substantial product in the 16S-23S rRNA screens in eleven... curing trial, shown by bacterial 16S rRNA gene product (Figure 4.4). However... products for either the bacterial 16S-23S rRNA PCR screen or... lanes in the H. defensa and 16S-23S rRNA screens in which... of products generated in the 16S-23S rRNA and H. defensa screens... templates were positive in the 16S rRNA screen (Figure 4.5), indicating the... were also produced in the 16S-23S rRNA screen, signifying the... H. defensa, though products in the 16S-23S rRNA screen indicate the... levels of product in the 16S-23S screen (data not shown... indicates the lane in the 16S-23S rRNA screen corresponding to... only a faint band in the 16S-23S rRNA screen. This indicated... the parasitoid, although the weak 16S-23S rRNA result implies that... (2), pp. 63–69. Lane, D.J. (1991). 16S/23S rRNA sequencing. In: E. Stackebrandt... length polymorphisms of genes encoding 16S rRNA. Applied and Environmental Microbiology... endosymbiont of aphids) contains a putative 16S rRNA operon unlinked to the... of aphids) unlinked to the 16S rRNA-encoding gene. Gene. 155... relationships established by analysis of 16S rRNAs. Journal of Bacteriology. 171.... Weisburg, W.G., Barns, S.M., Pelletier, D.A. & Lane, D.J. (1991). 16S ribosomal DNA amplification for phylogenetic... 16S rRNA 16S-23S rRNA S. symbiotica 16S rRNA H. defensa 16S rRNA R. insecticola 16S rRNA PAXS 16S rRNA Rickettsia 16S rRNA Spiroplasma 16S rRNA Rickettsiella 16S... amplifying 16S rRNA, 16S-23S rRNA, S. symbiotica 16S rRNA, H. defensa 16S rRNA and R. insecticola 16S... PCR (for amplifying PAXS 16S rRNA and Rickettsiella 16S rRNA; also used... PCR (for amplifying Rickettsia 16S rRNA and Spiroplasma 16S rRNA) Time 2 minutes...



Дата загрузки: 2017-12-10
Скачать документ
Скачать текст
0.34/5
... molekuler dilakukan berdasarkan sekuen gen 16S rRNA. Sebanyak 58 isolat bakteri... identification was conducted based on 16S rRNA gene sequence. It was... dan NTT3e................................................. 4 Hasil analisis gen 16S rRNA isolat-isolat pendegradasi AHL... pita DNA hasil amplifikasi gen 16S rRNA pada isolat pendegradasi AHL... NTT3e ............... 12 Hasil sekuen gen 16S rRNA dan BLAST-N isolat PAD1a... diidentifikasi secara molekuler. Amplifikasi gen 16S rRNA dilakukan menggunakan primer 63f... (72ºC, 5 menit). Hasil amplifikasi gen 16s rRNA kemudian dikirim ke perusahaan... (99%) (b) Tabel 5 Hasil analisis gen 16S rRNA isolat-isolat pendegradasi AHL... gen aiiA dilakukan identifikasi gen 16S rRNA terhadap enam isolat yang... 1300 bp (Gambar 3). Analisis gen 16S rRNA menunjukkan isolat NTT3a, NTT3e... pita DNA hasil amplifikasi gen 16S rRNA pada isolat pendegradasi AHL... dengan diameter zona Amplifikasi gen 16S rRNA isolat PAD1a, degradasi 0.9 cm... 1300 bp (Gambar 2). Analisis gen 16S rRNA NTT3a dan NTT3e relatif... aktivitas AHL-acylase. Hasil analisis 16S rRNA menunjukkan isolat Amplifikasi gen... amplikon hasil PCR gen analisis 16S rRNA isolat NTT6B7 mirip aiiA... pada Bacillus sp. 91. Gen 16S rRNA isolat NTT3e mirip dengan... gen aiiAnya. Berdasarkan analisis gen 16S rRNA, isolat PAD1a mirip dengan... amplify genes coding for bacterial 16S rRNA. Appl Environ Microbiol 64... 15 Lampiran 5 Hasil sekuen gen 16S rRNA dan BLAST-N isolat PAD1a..., dan NTT6B7 A) Urutan nukleotida gen 16S rRNA isolat PAD1a TTTGGAAAGATTTTTCGGTTGGGGATGGGCTCGCGGCCTATCAGCTTGTTGGTGAGGTAATGGCTCACCA AGGCGTCGACGGGTAGCCGGCCTGAGAGGGTGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCC... GC B) Hasil BLAST-N sekuen gen 16S rRNA isolat PAD1a dengan data Genbank |HQ916747.1| Microbacterium sp. Bg-7 16S ribosomal RNA gene, partial sequence...-GGTACAAAGGGC 1179 C) Urutan nukleotida gen 16S rRNA isolat BAL2a GCNCNGTGANTTAGCGGCGGACGGGAGAGTCACACGTGGGTCACCTACCTATNAGACTGGTATCACTCC GGGAAACCGGGGCTAATGCCGGATAACATTTAGAACCGCGTGGTTCTCAAGTGAAGGATGGTTTTGCTAT... AGTCACGCNTAANGATGAGTGCTAGTGTAGGNNNNCNNNNTAGTGCTGCAGCTANGCATTAGCA D) Hasil BLAST-N sekuen gen 16S rRNA isolat BAL2a dengan data... |JF072163.1| Uncultured bacterium clone ncd1261e03c1 16S ribosomal RNA gene, partial sequence... CTGACGCTGATGTGCGAAAGCGT 752 E) Urutan nukleotida gen 16S rRNA isolat NTT3a GGGAGAAGTATAGAGCTGCTCTTATGAAGTTAGCGGCGGACGGGTGAGTAACACGTGGTGTAACCTGCC CATAAGACTGGTATAACTCCGGGAAACCGGGGCTAATACCGGAATAATATTTTGAACCGCATGGTTCGC... TGGCACCTTGACGGTACCTAACCATAAAGCCACGGCTAACTACGTGCCAGCACCCGCGATTATACT F) Hasil BLAST-N sekuen gen 16S rRNA isolat NTT3a dengan data... |FJ611939.1| Bacillus sp. AF-777 16S ribosomal RNA gene, partial sequence... TACCTAACCAGAAAGCCACGGCTAACTACGTGCCAGCAGCCGCGGTAATAC 538 G) Urutan nukleotida gen 16S rRNA isolat NTT3e GGGGAAGGGTTAGAGCTTGCTCTTATGAAGTTAGCGGCGGACGGGTGAGTAACACGTGGGTAACCTGCC CATAAGACTGGGATAACTCCGGGAAACCGGGGCTAATACCGGATAACATTTTGAACCGCATGGTTCGAA... ATGAGTGCTAAGTGTTAGAGGGTTTCCGCCCTTTACTGCTGCAGTTTAACGCATTTAATAATTTC H) Hasil BLAST-N sekuen gen 16S rRNA isolat NTT3e dengan data... |AM981260.1| Bacillus sp. NIOT-3 partial 16S rRNA gene, isolate NIOT-3 Length...-AACGCATT 839 I) Urutan nukleotida gen 16S rRNA isolat NTT6B6 GGGGGGGAAAAGGGACTTGCTCCCTGATGTTAGCGGCGGACGGGTGAGTAACACGTGGGTAACCTGCCT GTAAGACTGGGATAACTCCGGGAAACCGGGGCTAATACCGGATGGTTGTTTGAACCGCATGGTTCAAAC... CAAACCGGAGGAAGGTGGGGATGACGTCAAATCATCATGCCCCT J) Hasil BLAST-N sekuen gen 16S rRNA isolat NTT6B6 dengan data... |EF101707.1| Bacillus subtilis strain HU48 16S ribosomal RNA (rrnE) gene, partial... CATGCCCCT 1148 K) Urutan nukleotida gen 16S rRNA isolat NTT6B7 GGGGGGGGAAAATGGGAGCTTGCTCCTGATGTTAGCGGCGGACGGGTGAGTAACACGTGGGTAACCTGC CTGTAAGACTGGGATAACTCCGGGAAACCGGGGCTAATACCGGATGGTTGTTTGAACCGCATGGTTCAA... 21 L) Hasil BLAST-N sekuen gen 16S rRNA isolat NTT6B7 dengan data... |HM055597.1| Bacillus subtilis strain GD1 16S ribosomal RNA gene, partial sequence...