Спутник ДЗЗ. IGS 1A. [Редактировать]

Космический аппарат ДЗЗ IGS, разработан корпорацией Mitsubishi Electric. Целевым назначением космического аппарата является разведка. По некоторым данным САС аппарата составляет 5 лет.

Дополнительные наименования

#НаименованияПоиск в новостяхПоиск в документах
1Information Gathering Satellite 1AНайтиНайти

Дополнительная классификация

1Страна оператор(владелец) - Япония
2Тип оператора(владельца) - государственный
3Тип орбиты - НОО
4Страна производитель - Япония
5Все спутники ДЗЗ

Новостная лента[Найти информацию в новостях] [Найти информацию в документах]

#Новостная лента.
12007-03-25. Отключен после проблем с системой энергопитанияТэги: IGS 1A
22014-07-18. Аппарат окончил свое активное существование.
IGS 1A – японский разведывательный спутник массой 850 кг, выведенный на орбиту 28.03.2003 японской ракетой-носителем H-2A-2024 с космодрома «Танегасима». По данным USSTRATCOM данный космический объект достиг высоты 10 км 18.07.2014 в 14:46:00 UTC +/-7 минут в точке с координатами 40,0°ю.ш., 54,0°з.д.Тэги: IGS 1A

Технические характеристики

1Масса, кг850
2Разрешение оптической спецаппаратуры (мультиспектральный), метра4.5
3Разрешение оптической спецаппаратуры (панхроматический), метра1

Пусковые характеристики

1Код NSSDC2003-009A

Информация об удачном запуске

1Космодром Танегасима
2Дата пуска2003-03-28 at 01:27:00 UTC
3Полезная нагрузка 1xIGS 1A
4Полезная нагрузка 1xIGS 1B
5Ракета-носитель 1xH2A2024

Найдено 445 документов по запросу «IGS 1A». [Перейти к поиску]

Дата загрузки: 2017-06-14
Скачать документ
Скачать текст
... consistent with recombination. The coalescent IGS genealogy confirmed subdivision and showed... of the nuclear ribosomal repeat (IGS) was an especially useful locus... the previous study, the 4-kb IGS was subdivided into 10 smaller... sites in each region (Fig. 1). IGS 1a and 2a are on one... break between recombination blocks, and IGS 9a and 10a are on... four selected subregions of the IGS, the EF-1α, and pLK44.11... aligned sequences from different loci, (e.g., IGS 1a, 2a, 9a, and 10a) into... not (P < 0.05). When Fig. 1. The IGS locus, showing primers NLF2 and... overlapping regions were used, e.g., IGS 1a-11b and IGS 2a-10b for the... Primer Sequence (5′ – 3′)b IGS IGS-1a IGS-11b IGS-2a IGS-10b IGS-3b IGS-10a IGS-2b CTCTCACCAAGGCATTGAGC TACACTCACCTCACCGGTAG... identified previously in the Americas, IGS 9a-10a sequence (approximately 800... the 4 kb of the entire IGS analyzed by Carbone and Kohn... the only portion of the IGS common to the present and... from multilocus data set. The IGS DNA sequence was analyzed first... blocks previously detected in the IGS (10). Much of the conflict..., IGS 1a-2a (which still presents internal conflict, [Fig. 3B]) and IGS 9a.... From a total of 754 bp, IGS 9a-10a presented 43 variable... in the case of the IGS locus, the Snn statistic showed... compatibility matrices for the locus IGS, generated using SNAP Clade (Markwordt.... A, Compatibility matrix for the combined IGS 1a, 2a, 9a, and 10 sequence... C, Compatibility matrices for the IGS 1a-2a and IGS 9a-10a sequences, respectively... the one obtained for the IGS 9a-10. Despite the lower... the intralocus conflict in the IGS. Given the genetic isolation of... combined data set, only the IGS 9a-10a was used. The... loci generated using SNAP Map (3). A, IGS 9a-10a; B, EF-1α; and C, 44..., and Washington for the loci IGS 9a-10a, EF-1α, and 44.11 IGS EF-1α 44.11 California Ontario... using MDIV (42) for the IGS 9a-10a. A, California versus Ontario... in the population-level analysis, IGS, EF1-α, and 44.11. The..., compared with species lineages. The IGS was an especially rich source... of Sclerotinia (10). Only the IGS provided enough characters to differentiate... the Ontario sample. Both the IGS and 44.11 differentiated a Washington... subdivision, Snn. Polymorphisms in the IGS provided higher resolution than the... a different genotype; recombination within the IGS locus; and interlocus recombination (IA... Genetree (4,19) for the loci IGS 9a-10a, 44.11, and... the mutations in the genealogy. A, IGS 9a-10a; B, 44.11; and...- Fig. 8. A, Haplotype map for the IGS 9a-10a locus for the... for North America for locus IGS 9a-10a ON AB NC...

Дата загрузки: 2017-01-23
Скачать документ
Скачать текст
... regions, IGSI and IGSII. The IGS region is the most rapidly... C. gattii. Genotype 6 is a newly described IGS genotypic group within the C. neoformans... complex. With the inclusion of IGS subgenotypic groups, our sequence analysis... of multiple alleles at the IGS locus in several hybrid strains, yielded a single IGS sequence type per isolate, thus... mono-allelic at this locus. IGS sequence analyses proved to be... reserved. Keywords: Yeast; Intergenic spacer (IGS); Length polymorphism; Repeated motifs; Cryptococcus... DNA amplification of the IGS regions employed a primer walking technique... Strain Source of isolation Serotype IGS genotype AFLP Type GenBank # C. neoformans... A A A A A A A A A A A A A A A A A A A A A 1a 1a 1a 1a 1a 1a 1a 1a 1a 1a 1a 1a 1a 1a 1a 1b 1a 1a 1a 1a 1b 1a 1c 1b 1b 1a 1a 1b 1a 1a 1a 1b 1a 1a 1a 1a 1a 1b 1a 1b 1a 1c 1c 1b 1a 1a 1a 1c 1 1 1 1 1 1 1 1A 1 1 1 1 1 1 1 1 3 3 1 ? 1 1 1A 1 1 1 1A 1 1A 1A 1 1 1 1 1 1 1 1 1 1 1 1A 1A 1 1 1 1 1A =DQ007972...) Strain Source of isolation Serotype IGS genotype AFLP Type GenBank # CBS... analysis with 500 replications. 3. Results 3.1. IGS sequence analysis The sequence strategy... the 5S RNA gene of IGS genotypes 1 and 2 (Fig. 1). A high similarity... rRNA gene, which divided the IGS region into two regions (Fig... the repeat, followed by genotypes 1a and 1b, with three copies... lineages. The first clade or IGS genotype 1 was mostly represented by... 6 (serotypes C). Genotype 6 is a newly discovered IGS genotypic group comprising two isolates... of C. neoformans var. grubii (genotypes 1a, 1b and 1c) and genotype... of multiple alleles of the IGS locus, amplicons from serotype AD..., e.g., RV 61756 and BA4, and IGS genotype 3 isolates, e.g., CBS 1930 (sero... (IGS 2c – serotype A), RV 52733 (IGS 1a – serotype D); CBS 6956 (IGS 3 – serotype B), CBS 6996 (IGS 5 – serotype B), CBS 5756 (IGS 1a – serotype A), CBS 7750 (IGS..., e.g., CBS 1143 (IGS 1a – serotype A), CBS 5474 (IGS 2c – serotype D), 48A (IGS 4c – serotype B) and CBS 6955 (IGS 5 – serotype... organization and characterization of the IGS region The overall molecular structure of the rDNA IGS of C. neoformans species complex follows... found between the different IGS genotypes. Most of the observed... the prominent features of the IGS region, are found in the... addition, we included a new IGS genotypic group (IGS genotype 6) based on unique... complex consists of six major IGS types. Besides these genotypic groups... our previous study [19], our IGS data were not fully concordant... the genotypes increased when both IGS regions were included in the phylogenetic analysis. Overall, our IGS genetic lineages are in agreement...: IGS genotype 1 = AFLP 1 + AFLP 1A; IGS genotype 2 = AFLP 2; IGS genotype 3 = AFLP 6; IGS genotype 4 = AFLP 4; IGS genotype 5 = AFLP 5 and IGS genotype... members of IGS genotypes 1 or 2 (Fig. 2). Even though, our IGS genotypic classi... analysis failed to discern the IGS sub-genotypes 1b and 1c... with our findings on the IGS genotype 2. In addition, isolates comprising... 4A clustered randomly in our IGS genotypes 4a, 4b and 4c... technique that agreed with our IGS classification. Other fingerprinting techniques...]. However, if we include our IGS subtypes as independent lineages, our...-genotypes was possible since the IGS region is a fast-evolving region... of genetic heterogeneity among the IGS genotypes and sub-genotypes can...firmed by multiple gene analysis, i.e., IGS, ITS, laccase gene, mitochondrial large.... We consider it likely that IGS genotype 2 (=AFLP genotype 2) represents an... + 5S rRNA + IGSII indicated that IGS genotype 3 is closer related to... ITS type 6, which corresponds to IGS genotype 6, was phylogenetically closer related... type 5 (=IGS genotype 5) and ITS type 4 (=IGS genotype 3). Overall, the IGS of C. gattii... cloned PCR amplicons of the IGS did not indicate the presence... the ITS region [49]. Our IGS cloning analysis revealed that the... of serotypeAD isolates at the IGS locus. Although serotype-AD strains... [17,19], the inclusion of IGS genotype 6 (serotype C) as a new phylogenetic... cloning analysis with C. gattii isolates (IGS genotype 3 = AFLP 6) indicated that these... not heterozygotous diploids for the IGS locus. Similar findings based on... by Latouche et al. [51]. IGS genotype 3, which was previously thought... dispersal model might explain why IGS sequences did not discriminate among...firms the utility of the IGS region as a powerful tool for... analyses of the intergenic spacer (IGS) associated with rDNA of the..., J.W. (2000) Molecular analyses of the IGS and ITS regions rDNA of... Phaffia rhodozyma based on rDNA IGS and ITS sequence analysis. J. Indust...

Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
... Vereinigung (N.E.V.) in Amsterdam aufbewahrten Werken. 1a,b, Nr. 4,5: ESPER (1783); 2a-d, Nr.... pyramus; 7: ssp. dalmata. Reproduktionen: D. JUTZELER 1a 2a 2c 2b 1b 3 5a... Vereinigung (N.E.V.) in Amsterdam aufbewahrt sind. 1a,b, Nr. 1,2: DRURY (1782), « Papilio Afer... Kozani; 8: Oberseite. Photos : Tristan LAFRANCHIS 1a 1b 5 6 2a 2c 2b 2d..., Roret (E. afra : 170, pl. 34, igs 1,2). BOISDUVAL J.B.A. (1840) Genera et index...: vol. 3, ex. Ent. 3: tab. 136, igs 1,2). DUPONCHEL P.A.J. (1832) Histoire Naturelle des... (Satyrus Afer : 224 ; pl. 34, igs 1,2). EIFFINGER G. in SEITZ A. (1907-1909... (P. afer: Bd. 2: p. 161 + pl. 83, igs 4,5 [1783]). EVERSMANN E. (1844) Fauna Lepidopterologica.... 8 [1796], p. 13; pl. 201, igs 7,8, pl. 202, igs 1,2). HEPPNER J.B. (1981) The dates..., I: Papilios. Papilio Phegea: pl. 98, igs 500-501 [1803-04]; Beschreibung... Textband [1805] p. 35; pl. 149, igs 749-751 [1817]. jakŠić P. (1993..., London (E. Afra: 254; pl. 57, igs 1). LEDERER J. (1853) Lepidopterologisches aus Sibirien...: 64, pl. IX, ig. 2 + pl. X, igs 1a,b). NEKRUTENKO Y. (1990) The butterlies of... publishers, Kyiv (P. afra: 124; p. 125, igs 132 (Ukrainisch). NICHOLL M. (1899) Butterly... afra: 116; pl. XIV/XV, igs. 4,8,12,15,19). TSHIKOLOVETS V. (2003... afra afra: 254; pl. 57, igs 13,14). TUZOV V.K., BOGDANOV P.V., DEVYATKIN... (P. afra afra: p. 216 et p. 373, igs 1-3). VERITY R. (1925) A Systematic Index of...

Дата загрузки: 2017-09-25
Скачать документ
Скачать текст
.... The two earliest satellites - IRS-1A (from 1988) and IRS-1B.... Later, two oceanographic satellites, MOS-1a and -1b, were operated between...) in 2002. Intelligence Gathering Satellites (IGS) However, in August 1998, North..., the first two of these IGS satellites were launched together using... failures. Both IGS satellites are quite large and heavy - IGS-1a carries an optical imager and weighs 850kg; IGS-1b has... of high-resolution satellites - IGS-2a and IGS-2b - into orbit took... H-IIA launcher. A new generation of IGS satellites giving images with 0.5m... the failed launch of the IGS-2 satellites. On board the ALOS...

Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
... commands . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . I/O lines functionality . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Ignition sense (IGS ) functionality . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17 17 17 17... interface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28 SDS interface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28 IGS feature. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29 7. CONNECTOR INTERFACES . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31... 12 V line and 1 A for the IGS line. Data Cable CA-125...), the green wire is the IGS signal, and the red wire... the power cable. Set the IGS signal (the green wire in... least one of the three IGS signals must be held high. Note: Every IGS signal has its own logic... DC input from 5A and 1A (IGS) fused 12 V power source line... accordingly (see Section Ignition sense (IGS ) functionality on page 20). Q Tracking... bringing high any of the IGS input signals. If the device... least one of the three IGS signals is held in the... high state. If all the IGS signals are kept in the..., you should permanently connect the IGS signal in the connector X104... is back within specified limits.1 IGS input , X103, X901: The TDM880i... the power on, set the IGS to logic high level (see... in this document. Q Ignition sense (IGS ) functionality The power on/off... in the TDM880i through an IGS input signal. The signal is... TDM880i, raise any of the IGS signal inputs into the high... at least one of the IGS signal inputs is held in... off the TDM880i, set all IGS inputs into the low state... delay. If any of the IGS inputs goes into the high... in the operational state. The IGS input is provided through the... 2 Logic high level of the IGS signals This document is the...

Дата загрузки: 2017-05-21
Скачать документ
Скачать текст
... simply as “Information Gathering Satellites” (IGS), the systems had to be... reconnaissance purposes. “Information Gathering Satellites” (IGS) - The system was first proposed... in March 2003, were IGS-1A (also known as IGS Radar-1 because of... radar) and the IGS-1B (also known as IGS Optical-1 because of... to a critical H-IIA failure. The IGS program was therefore set back... when two more IGSs (IGS-4A and IGS-4B) were successfully launched...—IGS-5 is expected to replace the IGS-1B optical satellite and another IGS (perhaps IGS-5B or IGS-6) will replace the IGS-1A radar satellite... perhaps an expansion of the IGS-series, will come into being...

Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
... and the 5S rDNA genes (IGS 1) were compared in six Pst... AFLP groups. Two PCR products (IGS 1A and IGS 1B, of 1.3 and 1.1 kb... all isolates. Further analysis of IGS 1A or IGS 1B showed that a low... (from 0 to 1.5%). Comparison of IGS 1A and IGS 1B with each other showed... the coexistence of two different IGS 1 types within one isolate. Either... fungus contains one type of IGS 1, or there are two discrete...

Дата загрузки: 2017-09-24
Скачать документ
Скачать текст
... Essaim 2 Essaim 1 CERISE H-IIA 2024 IGS-1a Kosmos-11K65M Kosmos 11K65M Kosmos... H-IIA 2024 Ariane 44L Shaviyt 1 IGS-1b Japan Sicral Italy Ofeq... Ariane 40 Ariane 40 Helios 1A Ariane 5G+ Ariane 40 Helios... Three 166 Ariane 44LP STRV 1A US US US FLTSATCOM F4... 45 Gunter Dirk Krebs, “Telecom 1A, 1B, 1C,” Gunters Space Page....htm. 76 Gunter Dirk Krebs, “IGS-Optical 1, 2,” Gunter’s Space Page, 4 January...://www.skyrocket.de/space/doc_sdat/igs-optical-1.htm; Gunter Dirk Krebs, “IGS-Radarl 1, 2,” Gunter’s Space Page, 4 January ...://www.skyrocket.de/space/doc_sdat/igs-radar-1.htm. Military Balance 2003...

Дата загрузки: 2017-04-24
Скачать документ
Скачать текст
... of electricity per second (or: 1A = 1C/s) Ah . . . . . . . . . . . . ampere hour Å . . . . . . . . . . . . . angstrom... for Europe), FIG, IAG, IAIN, IGS, NU OOSA and URSI. The.... IGRF . . . . . . . . . . International Geomagnetic Reference Field IGS . . . . . . . . . . . . International GNSS Service (since 1993... GPS Service”), as of 2006 IGS comprises 200 agencies worldwide and 350 ground stations IGS . . . . . . . . . . . . Information Gathering Satellite [a classified Japanese... two IGS satellites took place on March 28, 2003]. The IGS---1a S/C (optical imaging) has a mass of 850 kg at launch, the IGS... a mass of 1200 kg. The IGS S/C were built by Mitsubishi and... (Japan Inter--Design Forum). The IGS program was approved by the... Sensing Satellites (ISRO), D.24 (IRS---1A, 1B, 1C, 1D, 1E, etc...

Дата загрузки: 2017-04-24
Скачать документ
Скачать текст
... LEO 03/12/1999 Helios 1A Ariane 40 France Imaging LEO.../2001 IGS-1b H-IIA 2024 Japan Imaging LEO 28/03/2003 IGS-1a... GEO* 17/06/1994 STRV 1A Ariane 44LP France Technology GEO... Pike. Gunter Dirk Krebs, “Telecom 1A, 1B, 1C,” Gunters Space Page...-2004, p. 292. Gunter Dirk Krebs, “IGS-Optical 1, 2,” Gunter’s Space Page, 4 January...://www.skyrocket.de/space/doc_sdat/igs-optical-1.htm; Gunter Dirk Krebs, “IGS-Radarl 1, 2,” Gunter’s Space Page, 4 January ...://www.skyrocket.de/space/doc_sdat/igs-radar-1.htm. 76 77 “Information...