Спутник ДЗЗ. IGS O-2a. [Редактировать]

Космический аппарат ДЗЗ IGS, разработан корпорацией Mitsubishi Electric. Целевым назначением космического аппарата является разведка. По некоторым данным САС аппарата составляет 5 лет.

Дополнительная классификация

#Наименования
1Страна оператор(владелец) - Япония
2Тип оператора(владельца) - государственный
3Тип орбиты - НОО
4Страна производитель - Япония
5Все спутники ДЗЗ

Технические характеристики

#ХарактеристикаЗначение
1Масса, кг850
2Разрешение оптической спецаппаратуры (мультиспектральный), метра4.5
3Разрешение оптической спецаппаратуры (панхроматический), метра1

Информация о неудачном запуске

#ХарактеристикаЗначение
1Космодром Танегасима
2Дата пуска2003-11-29
3Полезная нагрузка 1xIGS O-2a
4Полезная нагрузка 1xIGS R-2a
5Ракета-носитель 1xH2A2024

Найдено 366 документов по запросу «IGS O-2a». [Перейти к поиску]


Дата загрузки: 2017-06-14
Скачать документ
Скачать текст
0.1/5
... consistent with recombination. The coalescent IGS genealogy confirmed subdivision and showed... of the nuclear ribosomal repeat (IGS) was an especially useful locus... the previous study, the 4-kb IGS was subdivided into 10 smaller... in each region (Fig. 1). IGS 1a and 2a are on one side... break between recombination blocks, and IGS 9a and 10a are on... four selected subregions of the IGS, the EF-1α, and pLK44.11... aligned sequences from different loci, (e.g., IGS 1a, 2a, 9a, and 10a) into... not (P < 0.05). When Fig. 1. The IGS locus, showing primers NLF2 and... regions were used, e.g., IGS 1a-11b and IGS 2a-10b for the 5′ region... Primer Sequence (5′ – 3′)b IGS IGS-1a IGS-11b IGS-2a IGS-10b IGS-3b IGS-10a IGS-2b CTCTCACCAAGGCATTGAGC TACACTCACCTCACCGGTAG... identified previously in the Americas, IGS 9a-10a sequence (approximately 800... the 4 kb of the entire IGS analyzed by Carbone and Kohn... the only portion of the IGS common to the present and... G. Malvárez G. Malvárez Population 3-2a Population 3-3a a Population 3-3 Population 3-4a... from multilocus data set. The IGS DNA sequence was analyzed first.... The compatibility matrix for IGS1a, 2a, 9a, and10a revealed conflict (Fig... blocks previously detected in the IGS (10). Much of the conflict..., IGS 1a-2a (which still presents internal conflict, [Fig. 3B]) and IGS 9a.... From a total of 754 bp, IGS 9a-10a presented 43 variable... in the case of the IGS locus, the Snn statistic showed... compatibility matrices for the locus IGS, generated using SNAP Clade (Markwordt.... A, Compatibility matrix for the combined IGS 1a, 2a, 9a, and 10 sequence... C, Compatibility matrices for the IGS 1a-2a and IGS 9a-10a sequences, respectively... the one obtained for the IGS 9a-10. Despite the lower... the intralocus conflict in the IGS. Given the genetic isolation of... combined data set, only the IGS 9a-10a was used. The... loci generated using SNAP Map (3). A, IGS 9a-10a; B, EF-1α; and C, 44..., and Washington for the loci IGS 9a-10a, EF-1α, and 44.11 IGS EF-1α 44.11 California Ontario... using MDIV (42) for the IGS 9a-10a. A, California versus Ontario... in the population-level analysis, IGS, EF1-α, and 44.11. The..., compared with species lineages. The IGS was an especially rich source... of Sclerotinia (10). Only the IGS provided enough characters to differentiate... the Ontario sample. Both the IGS and 44.11 differentiated a Washington... subdivision, Snn. Polymorphisms in the IGS provided higher resolution than the... a different genotype; recombination within the IGS locus; and interlocus recombination (IA... Genetree (4,19) for the loci IGS 9a-10a, 44.11, and... the mutations in the genealogy. A, IGS 9a-10a; B, 44.11; and...- Fig. 8. A, Haplotype map for the IGS 9a-10a locus for the... for North America for locus IGS 9a-10a ON AB NC...



Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
0.05/5
...-2002 270 BGM-71E TOW-2A and/or BGM-71F TOW... incl or only practice TOW-2A missiles) 19 M-113 APC -2000... missile 2008 2008 2028 TOW-2A version 1 E-2C Hawkeye Second-hand... Corvette 2010 $319 m deal; TOW-2A version $165 m deal 1 DB-110... M-113A2 Mk1J BGM-71E TOW-2A and/or BGM71F TOW-2B..., 2015 86 BGM-71E TOW-2A version $12 m deal (incl 30... July 13, 2015 90 TOW-2A version Possibly $178 m deal; AIM... from UK BGM-71E TOW-2A version Part of $1.1 b deal; for... $416 m deal; BGM-71E TOW-2A version; for National Guard Second... production line BGM-71E TOW-2A version Probably Secondhand Second-hand... 2011 $177 m deal; BGM71E TOW-2A version; for National Guard Saudi... Guard BGM-71 TOW-2A and TOW-2A-RF versions; incl 9740... from the HY-1 missile  HY-2A: IR-guidance variant  HY-2AII: Improved variant of the HY-2A  HY-2B: Improved radar-guidance... inertial + infrared homing guidance (HY-2A); or inertial + monopulse active radar... or wards, such as Wards 2A, 209, 240, and 350 of... reportedly ran Evin Prison’s Ward 2A and Gohardasht Prison’s Ward 8. Human... the judiciary. The inspectors general (IGs), under the jurisdiction of the... internal but independent oversight. The IGs may render administrative decisions and... COI, and representatives of the IGs’ offices. When the agenda of... section 2.a.). Government officials and the IGs frequently contended that corruption investigations... to appear in court. The IGs claimed some ministers stifled their... lift by a majority vote. The IGs and other anticorruption officials lacked... security. High turnover among the IGs left positions unfilled for long periods. The IGs reported that these deficiencies were... Audit, COI, Central Bank, and IGs by leaving many officials in...-Tracked Wire-Guided Missiles (TOW-2A), 7 Fly-to-Buy RF TOW2A...-1RF Bunker Buster Missiles (TOW-2A), 7 Fly-to-Buy RF Bunker Buster Missiles (TOW-2A), 48 TOW-2 Launchers, AN/UAS... Navigation System (EGI), 6 AN/AVR-2A/B Laser Warning Detectors, 12 M261... Sale to Kuwait of TOW-2A/B Radio Frequency Missiles as well... a possible sale of 2,106 TOW-2A Radio Frequency missiles, 21 Buy... to Kuwait of 436 TOW-2A/B Anti-armor Guided Missiles as... sale of 288 TOW-2A missiles, 4 TOW-2A Flyto- Buy missiles, 140... tube-launched, optically-tracked wireguided 2A/2B radio-frequency (RF) Missiles... sale of 9,650 BGM-71 2A Tube-Launched, Optically-Tracked Wire... Aero RF missiles, 91 TOW-2A Fly-to-Buy missiles, 49... TOW2B missiles, 1,000 BGM-71 2A TOW missiles, 7 Fly-to-Buy...-Launched, Optically-Tracked, WireGuided (TOW-2A) Radio Frequency missiles and associated..., Optically-Tracked, Wire-Guided (TOW-2A) Radio Frequency missiles (42 missiles...



Дата загрузки: 2017-03-09
Скачать документ
Скачать текст
0.17/5
... wish to receive serious cases: – E.i.3.2a Results in Death – E.i.3.2b Life.../Number data element (G.k.2.1.1a, D.8.r.2a, D.10.8.r.3a) G.k.2.1.1a, D.8.r.2a, D.10.8.r.3a - MPID... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... be confirmed after ISO IDMP IGs are made available Business Rule... be confirmed after ISO IDMP IGs are made available Value Allowed... Text Business Rule(s) Mandatory if D.8.r.2a, D.10.8.r.2a, G.k.2.1.1a is populated Figure... (D.8.r.3a, D.10.8.r.3a, G.k.2.1.2a) D.8.r.3a, D.10.8.r.3a, G.k.2.1.2a - PhPID Version Date/Number... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... be confirmed after ISO IDMP IGs are made available Business Rule... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed...(s) Mandatory if D.8.r.3a, D.10.8.r.3a, G.k.2.1.2a is populated EU Individual Case... data element (D.8.r.EU.r.2a, D.10.8.r.EU.r.2a, G.k.2.3.r.2a) D.8.r.EU.r.2a, D.10.8.r.EU.r.2a, G.k.2.3.r.2a - Substance/Specified... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... be confirmed after ISO IDMP IGs are made available Business Rule... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... ISO IDMP IGs are made available Business Rule(s) Mandatory if G.k.2.3.r.2a is... be confirmed after ISO IDMP IGs are made available OID - Value... be confirmed after ISO IDMP IGs are made available Business Rule... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... be confirmed after ISO IDMP IGs are made available Business Rule... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... be confirmed after ISO IDMP IGs are made available Business Rule... requirements At least one of D.1, D.1.1.1,D.1.1.2, D.1.1.3,D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3,D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3. D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 ICH... (i.e. ‘CCYYMMDD’). At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5. See note 5 & 9 Mandatory... note 3 At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 ICH... CCYYMMDD (Minimum) Conditional-Mandatory ICH D.2.2a Age at Time of Onset... {Decade} Conditional-Mandatory Mandatory if D.2.2a is populated. See note 9 ICH... populated. At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 AN...-Mandatory At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5. See note 9 N - [0-6] - - - ICH... Text Optional Boolean - Optional AN D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 Minimum... Conditional-Mandatory EU D.8.r.1.EU.8 ICH D.8.r.2a ICH D.8.r.2b ICH D.8.r.3a ICH... / Specified Substance Name EU D.8.r.EU.r.2a Substance/Specified Substance TermID Version... is populated Mandatory if D.8.r.EU.r.2a is populated Mandatory if G.k.2.3.r.3b... Substance Name EU D.10.8.r.EU.r. 2a Substance/Specified Substance TermID Version... by the Reporter 1 N (1,2,3,4) Optional ICH E.i.3.2a Results in Death - Boolean - Mandatory... Must be the value 5 if E.i.3.2a = "True" Medical Confirmation by Healthcare... F.r.2.1 Test Name (free text) ICH F.r.2.2a ICH - - - Mandatory if F.r.2.2b or... G.k.1 ICH G.k.2.1.1a ICH G.k.2.1.1b ICH G.k.2.1.2a ICH G.k.2.1.2b ICH G.k.2.2 EU G.k.2.2.EU... G.k.2.1.2b is populated Mandatory if G.k.2.1.2a is populated - EU G.k.2.2.EU.9.r .1 Device... (repeat as necessary) ICH G.k.2.3.r.1 ICH G.k.2.3.r.2a ICH G.k.2.3.r.2b ICH G.k.2.3.r.3a Strength.../2013 - 250 - N Numeric Mandatory if G.k.2.3.r.2a is populated Mandatory if G.k.2.3.r.3b... AN Free Text Optional G.k.4.r.10.2a Route of Administration TermID Version... decimal point only. Mandatory if G.k.4.r.9.2a is populated. Mandatory if G.k.4.r.10... of Administration (free text) G.k.4.r.11.2a Parent Route of Administration TermID... Conditional-Mandatory Mandatory if G.k.4.r.11.2a is populated. - - - Mandatory if G.k.4.r.10... Primary Source 50 250 ICH G.k.7.r.2a ICH G.k.7.r.2b Indication (MedDRA code... only. See note 1 Mandatory if G.k.7.r.2a or G.k.7.r.1 is populated. See note...-Mandatory Mandatory if G.k.9.i.3.2a is populated N [1-4] Optional ICH G.k.9.i.3.2a ICH G.k.9.i.3.2b ICH... one of the following fields D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5. The use of...



Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
0.07/5
..., N Gengler A comparison of ITS and IGS sequences of ovine nematodes B Conneely... 1 2 3 4 5 87.0b 96.2d 100.2a 111.8c 1.56 0.001 Average....3b 1.71 0.017 0.027 35.2a 36.5b 1.78 0.113 0.840... 65.5 N1 10.0b a 32.2a 67.3 N2 10.6 0.15 0.30... 105.8 a 122.2 b 112.3 ab 136.2a 166.2 b 147.8a W2 146... 57.4b 0.48 KO% 53.2a 2.75a 3.18b 3.05b 0.095 Conformation... 175.4a 258.1a 344.2a 392.5a 421.3a 76... FSFM s.e.d P B (ml) 174.3b 186.2a 138.9c 0.5 0.01 C (ml/h) 0.016b... <.0001 NH3-N (mg/dl) 46.2a a c 0.65 0.82b 0.31 <.0001 SCFA.... 308 A comparison of ITS and IGS sequences of ovine nematodes B Conneely1... recent years the intergenic spacer (IGS) and internally transcribed spacer (ITS... of using the ITS and IGS regions as targets for a molecular...-1, 5.8s and ITS-2 region and IGS region of the rDNA were...-F 5’-ACCGTCGTGAGACAGGTTAG-3’, UniIGS-R 5’-CTGCTCTAATGAGCCGTTCG-3’for the IGS region. PCR reactions were carried... in Table 1. Amplification of the IGS region was unsuccessful. Table 1 Pairwise... m2 h2 σ2p σ2e σ2m σ2a ram Birth weight 0.08 0.37...



Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
0.08/5
... Werken. 1a,b, Nr. 4,5: ESPER (1783); 2a-d, Nr. 500,501: HÜBNER (180304...; 7: ssp. dalmata. Reproduktionen: D. JUTZELER 1a 2a 2c 2b 1b 3 5a 2d...), « Papilio Afer » aus Sierra Leone; 2a-d, Nr. 1,2,7,8 : HERBST (1796) ; 3a,b, Nr.... Photos : Tristan LAFRANCHIS 1a 1b 5 6 2a 2c 2b 2d 7 3a 3b..., Roret (E. afra : 170, pl. 34, igs 1,2). BOISDUVAL J.B.A. (1840) Genera et index...: vol. 3, ex. Ent. 3: tab. 136, igs 1,2). DUPONCHEL P.A.J. (1832) Histoire Naturelle des... (Satyrus Afer : 224 ; pl. 34, igs 1,2). EIFFINGER G. in SEITZ A. (1907-1909... (P. afer: Bd. 2: p. 161 + pl. 83, igs 4,5 [1783]). EVERSMANN E. (1844) Fauna Lepidopterologica.... 8 [1796], p. 13; pl. 201, igs 7,8, pl. 202, igs 1,2). HEPPNER J.B. (1981) The dates..., I: Papilios. Papilio Phegea: pl. 98, igs 500-501 [1803-04]; Beschreibung... Textband [1805] p. 35; pl. 149, igs 749-751 [1817]. jakŠić P. (1993..., London (E. Afra: 254; pl. 57, igs 1). LEDERER J. (1853) Lepidopterologisches aus Sibirien...: 64, pl. IX, ig. 2 + pl. X, igs 1a,b). NEKRUTENKO Y. (1990) The butterlies... publishers, Kyiv (P. afra: 124; p. 125, igs 132 (Ukrainisch). NICHOLL M. (1899) Butterly... afra: 116; pl. XIV/XV, igs. 4,8,12,15,19). TSHIKOLOVETS V. (2003... afra afra: 254; pl. 57, igs 13,14). TUZOV V.K., BOGDANOV P.V., DEVYATKIN... (P. afra afra: p. 216 et p. 373, igs 1-3). VERITY R. (1925) A Systematic Index of...



Дата загрузки: 2017-06-16
Скачать документ
Скачать текст
0.03/5
... в конце развертывания из условия δ ⎡ LAB = ϕ A 1 + ϕ2A + ln(ϕ A + 1 + ϕ2A )⎤ − ⎣ ⎦ 4π 8 δ ⎡ ϕ A 1 + ϕ A 2 + ln(ϕ A + 1 + ϕ A 2 )⎤ − ⎦ 4π ⎢⎣ δ − ⎡(ϕ A − 2π) 1 + (ϕ A − 2π)2 + 4π ⎣ (11) + ln((ϕ A − 2π) + 1 + (ϕ A − 2π)2 )⎤ . ⎦ Полный... барабана на произвольный угол ψ d , составит δ ⎡ s= ϕ A 1 + ϕ2A + ln(ϕ A + 1 + ϕ2A )⎤ − ⎣ ⎦ 4π δ − ⎡(ϕ A − 2π − ψ) 1 + (ϕ A − 2π − ψ)2 + 4π ⎣ + ln((ϕ A − 2π − ψ) + 1 + (ϕ A − 2π − ψ)2 )⎤ . (12) ⎦ При ψ d = 0 , т. е. до... моделей та методик обробки, впроваджених IGS з GPS-тижня 1400. Визначені координати... ассоциацией была создана Международная ГНССслужба (IGS). Главными задачами новой организации были... с GPS-недели 1400 (5 ноября 2006 г.) IGS вводит новые модели и методики обработки.... C этого же момента все продукты IGS, включая комбинированные точные эфемериды ГНСС...-станций, выражаются в системе координат IGS05 (IGS-реализация системы координат ITRF2005). В 2008 г. IGS начала кампанию репроцессинга (переобработки) архивных ... регулярной обработки CODE и кампании репроцессинга IGS [8] Рис. 2. Расположение GPSстанций, наблюдения которых.... Т. 17. № 5 41 М. В. Ищенко, О. А. Хода (вторая IGS-реализация ITRF2000) и значения зенитной тропосферной..., полученных в результате кампании репроцессинга, выполненной IGS, дало возможность организовать репроцессинг архивных... GPSспутников, полученные в результате кампании репроцессинга IGS; y параметры вращения Земли, согласующиеся с точными... GRAZ CNIV SHAZ TRAB 40° IGS Referense Frame stations other stations... processing procedures adopted by the IGS since GPS week 1400. Estimated...



Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
0.27/5
... a range of a few kilometres. Precise IGS orbits were used. When comparing....202 m) are shown below. Table 2a shows the correct values of... 2c. The values in Tables 2a and 2b show very small... of the kinematic positioning. Tab. 2a Correct double differences DDNW and... using L1 ambiguities in Table 2a 72209.24 72209.22 9:30... File: IGR, ESAG; Final File: IGS, CODG) Temp. Final Avg of... are not the final data (IGS, CODG) but the temporary data... orbits IGS and ionospheric delay estimates CODG are used time Fig. 2a... addition, GPS data from several IGS sites in China during the... PRN29 and PRN21 observed at IGS sites WUHN and BJFS respectively... connected to International GPS Service (IGS) network. The network records, distributes... River (01/09) Melb obs (IGS station) (18/11) Clayton (12... and 3-8mm in height using IGS final orbits products (Brown, 2002... ITRF, GDA, MGA grid, and IGS precise ephemeris, etc. Further investigation... by the International GPS Services (IGS, 2000). The deformation analysis can... GPSnet, relatively stable and precise IGS/ARGN reference stations close to..., the "Melbourne Observatory" station in IGS There are a number of different... a fixed datum derived from three IGS stations (HOB2,STR1,TIDB)is... network. Irymple TIDB (IGS) STR1 (IGS) Cann River IGS station HOB2 (IGS) Fig. 6 An... solution. AUSPOS processing engine uses IGS precise ephemeris products, Earth orientation... and differential technique to several IGS stations. The data processing is... Australian tectonic motion vector from IGS The total displacement magnitude "V" is... Figure 12) derived from other IGS measurements (Geoscience Australia, 2004b). Since... (11): 1035-1039. IGS (2000): International GPS Services (IGS) - International Terrestrial Reference... not relative) troposphere measurements, three IGS stations were included in the... available from BKG’s website (http://igs.ifag.de/ntrip_down.htm). 3.3 Using...-Wesley, Boston. Ntrip Homepage, http://igs.ifag.de/index_trip.htm. Radio... of 129 International GPS Service (IGS) sites across Europe for over... up components, respectively. The corresponding IGS SP3 final orbits were also... (4) into equation (2), we have n g = 1 − a1 / f 2 − 2a 2 / f 3 − 3a3 / f 4 (5) Wang et al.: Triple... (4) and (5) into equation (6) gives 2 293 − 2a 2 / f 3 − 3a3 / f 4 )ds (8) s ∫ ∫ ∫ s s s = − (a1 / f 2 )ds − 2 (a 2 / f 3 )ds...



Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
0.07/5
..., p. 106, f ig. 5; Gordon, 1984, p. 22, f igs. 3D–F; Cook, 1985, p. 196, figs... gigantea: Busk, 1856a, p. 93, pl. 5, f igs. 1–2. Busk, 1886, p. 39; Hincks, 1880a, p. 535, pl. 77, f igs. 3–4; 1887b, p. 128. Marcus, 1937, p. 131.... 7, f ig. 1; Harmer, 1915, p. 68, pl. 5, f igs. 6–7; Marcus, 1937, p. 134, pl. 27..., 1971, p. 488; Menon, 1972b, p. 612, f igs. 24–29; Winston, 1982, p. 110...; Marcus, 1937, p. 139, pl. 28, f igs. 75A–B. Zoobotryon verticillatum: Soule in..., 1963, p. 18; Menon, 1972b, p. 618, f igs. 35–37; Winston, 1982, p. 113.... 13; 1984, p. 6, f ig. 11; 2004, p. 7, f igs. 3–4; Bock, 1982, p. 333, f ig. 9.5c... Hincks, 1887b, p. 127, pl. 12, f igs. 9–13; Kirkpatrick, 1890b, p. 603; Harmer..., p. 203, pl. 1, figs. 1–11, pl. 2, f igs. 12–19; Rogick & Croasdale, 1949..., 1963, p. 20; Menon, 1972b, p. 624, f igs. 50–51. Material examinado Presente... Aetea anguina (Linnaeus, 1758) Prancha 2A–B, 3A Tabela 3 Sertularia anguina Anguinaria..., fig. 1; 1884, p. 2; Hincks, 1880a, p. 4, pl. 1, f igs. 4–5; Osburn, 1912, p. 220, pl. 21..., p. 345; Canu & Bassler, 1920, p. 179, f igs. 47A–C, pl. 32, figs. 2–3; Harmer, 1926, p. 194, pl. 13, f igs. 3–4; Hastings, 1930, p. 702; 1932, p. 408; 1943, p. 472, f igs. 57A–C; Marcus, 1937, p. 26, pl..., p. 5, pl. 1, f ig. 1; Bock, 1982, p. 341, f igs. 9.6d–f; Hay ward & Ry land.... 10; Osburn, 1940, p. 347, pl. 1, f igs. 9–11; Soule, 1959, p. 4.; Cook, 1968a, p. 137; Gordon, 1984, p. 39, pl. 8, f igs. E–F; 1986, p. 44; Fransen, 1986, p. 12..., p. 278; Rogick & Croasdale, 1949, p. 43, f igs. 1–3; Hay ward, 1971, p. 481; Winston...; Hay ward & McKinney, 2002, p. 14, f igs. 5A–C. Material examinado Presente estudo..., 1852b, p. 31; Hincks, 1880a, p. 8, pl. 1, f igs. 8–11, pl. 2, f ig. 3; Osburn, 1914...; Hay ward & McKinney , 2002, p. 14, f igs. 5D–F. ? Aetea truncata: Marcus, 1938a..., 1940, p. 349; 1950, p. 23, pl. 2, f igs. 4–6; Rogick & Croasdale, 1949, p. 63; Maturo..., p. 124; Hastings, 1930, p. 706, pl. 3, f igs. 9–10. Nitscheina tuberculata: Jellyella tuberculata..., 1963, p. 170; Cook, 1968b, p. 134, f igs. 6a–b; 1985, p. 89, f ig. 26B..., f ig. 33; Fransen, 1986, p. 14, f igs. 4a–c. Material examinado Presente estudo..., 1937, [in part] p. 37, pl. 6, f igs. 14A, E–F. [non figs. 14B–D]; ?Cook...; Dick, Tilbrook & Mawatari, 2006, p. 2209, f igs. 5A–B. Material examinado Presente estudo.... 4; Canu & Bassler, 1919, p. 82, pl. 2, f igs. 5–7; 1920, p. 196, pl. 82, figs..., p. 410; Marcus, 1939, p. 131, pl. 8, f igs. 9A–C; Lagaaij, 1963, p. 482, text...: Lev insen, 1909, p. 190, pl. 1, f igs. 13a–e; Cheetham, 1966, p. 48, f ig.... g; Fransen, 1986, p. 41, f igs. 14a–h; Winston, 2005, p. 10, f igs. 15–19. Material...–F, 10C Johnston, 1840, p. 272, f igs. 1–2; 1847, p. 372, f igs. 69–70; Busk, 1852b, p. 32, pl. 24, f igs. 4–5; Hincks, 1880a, p. 96, pl. 4, f igs. 8–10; Robertson, 1905..., p. 504, f ig. 1; Hastings, 1943, p. 361, f igs. 18A–D; Osburn, 1947, p. 20. Material...; Sav igny, 1817, pl. 11, f igs. 3 1–5 . Marcus, 1938a, p. 24, pl. 5, figs..., p. 243; Sav igny, 1817, pl. 8, f igs.4 Prancha 12D 1–5 . Pieper, 1881, p. 43, 47, pl. 2, f igs. 5–7. Kirkpatrick, 1888, p. 504. Harmer, 1926, p. 398, pl. 27, f igs. 3–4; Osburn, 1927, p. 126; 1940, p. 402..., pls. 10E–F; Fransen, 1986, p. 57, f igs. 10a–g; Tilbrook, Hay ward & Gordon, 2001, p. 52, f igs. 6A,C; Hay ward & McKinney , 2002, p. 26, f igs. 10E–F; Tilbrook, 2006, p. 65, plat...–F; Gluhak, Lewis & Popijac, 2007, p. 399, f igs 3A–B. Material examinado Presente estudo.... 4, f ig. 5. Osburn, 1940, p. 377, pl. 5, f igs. 40–41; 1950, p. 109, pl...; Soule, Soule & Chaney, 1999, p. 32, f igs. 48–50. Material examinado Presente..., p. 243; Sav igny, 1817, p. 13, f igs. 3 Cothurnicella deadala Chlidonia deadala: Chlidonia.... 3–5. MacGillivray , 1885, p. 35, pl. 108, f igs. 2–2b. Busk, 1884, p. 8, pl. 28..., 1968a, p. 154; Gordon, 1989a, p. 450, f igs. 4–8; Wyse Jackson & Spencer Jones, 1996, p. 407, f igs 6G–H. Material examinado Presente estudo...; Sav igny, 1817, pl. 13, f igs. 2 Prancha 15E–F 1–5 . Alysidium lafontii: Busk, 1852b, p. 14, pl. 14, f igs. 1–5. Catenaria lafontii: Harmer, 1902, p. 305...; Hay ward & McKinney, 2002, p. 40, f igs. 17D–F. Material examinado Presente estudo...; Sav igny, 1817, pl. 13, f igs. 1 Prancha 15A–B 1–5 . Marcus 1937, p. 76..., figs. 40A–B; 1938a, p.31, pl. 7, f igs. 17A–B; 1939, p. 113, pl. 8, f ig.... 174A–E; Osburn, 1940, p. 464, pl. 9, f igs. 78–79; Correa, 1947, p. 1. Vittaticella... Harmer, 1957, p. 772, pl. 50, f igs. 4–5,15; Lagaaij, 1963, p. 202, pl...–F; Gluhak, Lewis & Popijac, 2007, p. 412, f igs 17A–C. 73 Material examinado Presente.... 11B; Osburn, 1940, p. 462, pl. 9, f igs. 75–77; Winston, 1982, p. 152...; Cheetham, Sanner & Jackson, 2007, p. 67, f igs. 1.2, 30.1, 30.2. Material examinado Presente...–B; 1955, p. 297; Winston, 2005, p. 89, f igs. 247–256. Material examinado Presente.... 2–3; Marcus, 1939, p. 153, pl. 11, f igs. 20A–C; 1955: 303; Osburn, 1940...



Дата загрузки: 2017-06-16
Скачать документ
Скачать текст
0.08/5
... will be transmitted to THEOS IGS (Image Ground Segment). The role of THEOS IGS is to  provide value added... 120 Mbps)  up  to  level  2A.  The  4  working  stations  of  the... Segment (CGS)  o  Image Ground Segment (IGS) Figure 2. Spatial Performance of THEOS...  Absolute  localisation  accur acy (level 2A)  Off­nadir  viewing  PAN  panchromatic... Segment (CGS) :  2.  Image Ground Segment (IGS)  Contr ol Gr ound Segment...  120  Mbps)  up  to  Level  2A  which  can  be  done  through...  available  in  the  archive  through  IGS.  Secondly,  they  can  order  new... 8.  THEOS Ground Segment Operation Cycle  IGS.  This  can  be  done  according...  and  complete  the  cycle  through  IGS  where  the  image  is  downlinked...  data  can  be  processed  by 2  IGS  entities,  DPF  and  IEF  which..., non uniformities, MS registration)  Level 2A : Geometrical correction of systematic effects...  ground  segment  can  produce  level 2A products  in less than 30...



Дата загрузки: 2017-03-17
Скачать документ
Скачать текст
0.11/5
... WORKSHOP IN VENICE....................................................................... 25 4.1.4 HY-2A DATA DISTRIBUTION .......................................................................................................... 25 4.1.5 PLOTTOOL: A FAMILY... FOR ITRF2013 .............................................................................. 53 FIRST HY-2A ANALYSES ............................................................................................................ 55 COMMUNICATIONS..................................................................................................................... 56 FUTURE... series planned by China (HY-2A (2011), HY-2B (2012), HY... IGN/IPGP Analysis Center, France IGS International GNSS Service ILRS International... services - the International GNSS Service (IGS) for GPS, GLONASS and, in... data sets and products, the IGS was established and recognized as... to the other IAG Services (IGS: International GNSS Service, ILRS: International... web site in February. 4.1.4 HY-2A DATA DISTRIBUTION The Central Bureau... DORIS data of the HY-2A satellite. It coordinated the actions... POE processing; it includes HY-2A. (ftp://ftp.idsdoris.org/pub... Indies: reconnaissance in Guadeloupe, Martinique (IGS co-location)  Rio Grande: antenna... with a DGXX DORIS receiver.  HY-2A, a Chinese satellite (China Academy of... ENVISAT SPOT 5 JASON 2 CRYOSAT2 HY-2A SATELLITES 7 6 5 4 3 2 1 Figure 2 DORIS observations available... the other IAG geometric services (IGS, ILRS, IVS) and is shown... (SPOT-4, -5, Jason-1, -2, CryoSat-2, and HY-2A); data from future missions (e.g., SARAL... through 08-Apr-2012 HY-2A 01-Oct-2011 through present...) CryoSat-2 7 25 2.7 Envisat 6 26 1.9 HY-2A 7 29 3.1 Jason-1 11 27 3.5 Jason... from Jason-2, CryoSat-2, and HY-2A are also available in RINEX..., and 2.5 Mbytes for CryoSat-2, HY-2A, and Jason-2 respectively. In the... IAG services:      International GNSS Service (IGS) International Laser Ranging Service (ILRS... orbit determination results with HY-2A; (2) A report on the ground calibration... the utility of the HY-2A DORIS data. Guilhem Moreaux (CLS... of first series including HY-2A and iv) communications at EGU... to ITRF2008. 10.4 FIRST HY-2A ANALYSES At the end of... muti satellites solutions including HY-2A. HY-2A which was launched on... series shown that adding HY-2A has no major impact on... 30 (without HY-2A) and 32 (with HY-2A). 10.5 COMMUNICATIONS The... IERS 2003  Inclusion of HY-2A In 2012 we continued testing... for Jason-2, Cryosat-2 and HY-2A instead of the older DORIS... of the new satellite HY-2A in the combination. 12.2 SOUTH... estimates are provided by the IGS and were downloaded from the... collocated sites (from IDS and IGS networks) were chosen for comparison... are relevant to the METZ (IGS) [METB (IDS)] Kirkkonummi, Finland site..., to take into account HY-2A in the data analysis, to... solutions is lcawd30. When HY-2A data were made available, a second... as lcawd30 but with HY-2A in addition), has been generated... assess the contribution of HY-2A to the multi-satellite solutions... ENVISAT, Topex/Poseidon, Cryosat-2, HY-2A and the two Jason satellites... and daily EOP lcawd32 (+ HY-2a) 2011/10/02 - … STCD files... - … JASON-2: 2008 - CRYOSAT-2: 2010 - … HY-2A : 2011 - Table 11. List of... to take into account HY-2A. For this satellite, the data...) lets suggest also that HY-2A has reached a stable configuration (nominal... SRP coefficients estimated for HY-2A over 5 months IDS Annual Report 2012 74 HY-2A is now included in the... (1999), The International GPS Service (IGS), an interdisciplinary service in support... nouvelles mesures du satellite HY-2A et à l'amélioration ds mod...