Спутник ДЗЗ. IGS O-2a. [Редактировать]

Космический аппарат ДЗЗ IGS, разработан корпорацией Mitsubishi Electric. Целевым назначением космического аппарата является разведка. По некоторым данным САС аппарата составляет 5 лет.

Дополнительная классификация

#Наименования
1Страна оператор(владелец) - Япония
2Тип оператора(владельца) - государственный
3Тип орбиты - НОО
4Страна производитель - Япония
5Все спутники ДЗЗ

Технические характеристики

#ХарактеристикаЗначение
1Масса, кг850
2Разрешение оптической спецаппаратуры (мультиспектральный), метра4.5
3Разрешение оптической спецаппаратуры (панхроматический), метра1

Информация о неудачном запуске

#ХарактеристикаЗначение
1Космодром Танегасима
2Дата пуска2003-11-29
3Полезная нагрузка 1xIGS O-2a
4Полезная нагрузка 1xIGS R-2a
5Ракета-носитель 1xH2A2024

Найдено 517 документов по запросу «IGS O-2a». [Перейти к поиску]


Дата загрузки: 2017-06-14
Скачать документ
Скачать текст
0.09/5
... consistent with recombination. The coalescent IGS genealogy confirmed subdivision and showed... of the nuclear ribosomal repeat (IGS) was an especially useful locus... the previous study, the 4-kb IGS was subdivided into 10 smaller... in each region (Fig. 1). IGS 1a and 2a are on one side... break between recombination blocks, and IGS 9a and 10a are on... four selected subregions of the IGS, the EF-1α, and pLK44.11... aligned sequences from different loci, (e.g., IGS 1a, 2a, 9a, and 10a) into... not (P < 0.05). When Fig. 1. The IGS locus, showing primers NLF2 and... regions were used, e.g., IGS 1a-11b and IGS 2a-10b for the 5′ region... Primer Sequence (5′ – 3′)b IGS IGS-1a IGS-11b IGS-2a IGS-10b IGS-3b IGS-10a IGS-2b CTCTCACCAAGGCATTGAGC TACACTCACCTCACCGGTAG... identified previously in the Americas, IGS 9a-10a sequence (approximately 800... the 4 kb of the entire IGS analyzed by Carbone and Kohn... the only portion of the IGS common to the present and... G. Malvárez G. Malvárez Population 3-2a Population 3-3a a Population 3-3 Population 3-4a... from multilocus data set. The IGS DNA sequence was analyzed first.... The compatibility matrix for IGS1a, 2a, 9a, and10a revealed conflict (Fig... blocks previously detected in the IGS (10). Much of the conflict..., IGS 1a-2a (which still presents internal conflict, [Fig. 3B]) and IGS 9a.... From a total of 754 bp, IGS 9a-10a presented 43 variable... in the case of the IGS locus, the Snn statistic showed... compatibility matrices for the locus IGS, generated using SNAP Clade (Markwordt.... A, Compatibility matrix for the combined IGS 1a, 2a, 9a, and 10 sequence... C, Compatibility matrices for the IGS 1a-2a and IGS 9a-10a sequences, respectively... the one obtained for the IGS 9a-10. Despite the lower... the intralocus conflict in the IGS. Given the genetic isolation of... combined data set, only the IGS 9a-10a was used. The... loci generated using SNAP Map (3). A, IGS 9a-10a; B, EF-1α; and C, 44..., and Washington for the loci IGS 9a-10a, EF-1α, and 44.11 IGS EF-1α 44.11 California Ontario... using MDIV (42) for the IGS 9a-10a. A, California versus Ontario... in the population-level analysis, IGS, EF1-α, and 44.11. The..., compared with species lineages. The IGS was an especially rich source... of Sclerotinia (10). Only the IGS provided enough characters to differentiate... the Ontario sample. Both the IGS and 44.11 differentiated a Washington... subdivision, Snn. Polymorphisms in the IGS provided higher resolution than the... a different genotype; recombination within the IGS locus; and interlocus recombination (IA... Genetree (4,19) for the loci IGS 9a-10a, 44.11, and... the mutations in the genealogy. A, IGS 9a-10a; B, 44.11; and...- Fig. 8. A, Haplotype map for the IGS 9a-10a locus for the... for North America for locus IGS 9a-10a ON AB NC...



Дата загрузки: 2017-12-26
Скачать документ
Скачать текст
0.05/5
... Prometheus 1B – 2013-064E Prometheus 2A – 2013-064K Prometheus 2B – 2013...) – 2013-001C IGS 8A (IGS Radar 4) – 2013-002A IGS 8B (IGS Optical Demonstrator) -- 2013...-025D Nimiq 6 – 2012-026A Zhongxing 2A – 2012-028A Yaogan-15 – 2012... GOES-11 – 2000-022A BSAT-2A – 2001-011B ICO-F2 – 2001...-049A Arabsat-5C -- 2011-049B IGS-Optical 4 – 2011-050A Atlantic Bird...-074A Luch-5A – 2011-074B IGS-7A – 2011-075A ELISA-W23...-C – 2006-011C MIDstar-1 – 2007-006B IGS-4B – 2007-005B Egyptsat-1 – 2007... PakSat-1R – 2011-042A HaiYang 2A – 2011-043A EduSAT – 2011-044A...-035B AISSat 1 – 2010-035C Alsat 2A – 2010-035D TISat 1 – 2010-035E...-B – 2007-004B THEMIS-C – 2007-004C IGS-3B – 2007-005A Zheda Pixing...-064A Eutelsat W7 – 2009-065A IGS 5A – 2009-066A Intelsat 15...-019A GIOVE-B – 2008-020A CartoSat 2A – 2008-021A CAN-X6 – 2008...: LAPAN-Tubsat (2007-001A) CartoSat 2A (2007-001B) PehuenSat 1 (2007-001D...) THEMIS 5 (2007-004E) IGS 3B (2007-005A) IGS 4A (2007-005B) ASTRO...-043D) Cosmos 2388 (2002-017A) IGS-1B (2003-009B) Streak [STP... some satellite data Satellites Added: IGS-3A (Information Gathering Satellite 3A...-034A Spacenet-4 - 1991-028A Telecom 2A - 1991-084A UFO-3 (USA 104...



Дата загрузки: 2018-04-17
Скачать документ
Скачать текст
0.09/5
...-term Inoc1; Russ1; repeated vs 2a Pisol1; järgi prescribed põlengud, Thel1... ascomycete eriisendid Guidot A, Lumini E, Debaud IGS J-C, RFLP Marmeisse meetod R. geneti 1999... Ranjard L, Poly F, Lata J-C, Mougel bakteriteC,(IGS) Thioulouse ja seente J, Nazaret (ITS... trees of Calycadenia (Compositae). 18S-IGS praimer Mol. Phyl. Evol. 10... wastewater. J. Microbiol. reoveebakterite Meth. 57: IGS: 79-93. palju varieeruvam ja...-amplified Tylospora fibrillosa: ITS and IGS IGS,regions ITS -kultuurist of ribosomal...; fibrillosa: 126: 525-532. ECM IGS, ITS väga-kultuurist vilets amplifitseering..., ent ECMst väga vilets PCR IGS; 1 RE vs ECM vs EMH... enamasti koniid ja väga lähedalt IGS RFLP meetod geneti määramiseks ECMs..., domin ka viljakehadena ISSR>RAPD>>>IGS Suillusele. 1 ISSR marker Tomentella (Thelephoraceae..., siiski korge heterosügootsus ITS, IGS, mtLSU, mtSSU, ISSR n structure of... ITS 91: ja 163-172. IGS varianti. Trichaptum: Dik org-s mitukummaski... Dik ITS org-s ITS ja IGS vkummaski IGS varianti. versioon. tuumas Dik85...-s erinev juhtudest kummaski ITS vITS1 IGS tu ybridization among cryptic species... RAPDPress, eri liikidele. New York. IGS varieeruvam kui ITS ynthase homologs... Phytol. 139: 341-352. Pisolithus IGS ja ITS võrdselt variabiilsed f the.... Verticillium: Res. 99: 257-266. IGS ca 1570 bp, 5S Verticillium: RNA pole IGS sellescapaigas; 1570 bp, madal 5S.... Ruumilise varieeruvuse arvestamine ökoloogias. bakterite (IGS) ja seente (ITS) ARISA=ARDRA.... Ecology 87: S3-S13. Frankia IGS primer F16S gtgggaccggcgattgggac roparaonea, a new... tuuma ja mt DNA põhjal (IGS vs CTB); liigiteket on mõjutanud..., pink Piloderma, pink, Paxillus osa: IGS, ITS -kultuurist -ei mingit erinevust... sp ja Entoloma abortivum il IGS-RFLP: Armillaria Jaapanis; eri Armillaria...: regionaalne ristviljastumine, lo u ITS ja IGS varianti. Dik org-s kummaski tuumas erinev ITS v IGS versioon. 85% juhtudest ITS1 ja..., mis erinevad suure indeli poolest. IGS sisald v palju mikrosatelliite, mis on... replitseeritud, regiooni pikkused bakterite tihti (IGS) väljaspooli ja seenteandmebaasides (ITS) ARISA... genoomide sarnasuse ruumiline autok terite (IGS) ja seente (ITS) ARISA=ARDRA..., piikide pikkuse kvantit arvestamine, bakterite (IGS) kergejavarieeruvus seente (ITS) replikaatide ARISA... d, pop-struktuur ja ekstinktsioonid Frankia IGS primer F16S gtgggaccggcgattgggac. BD ei... 8a vastu , Hebeloma ja thelephora <2a tammeistandikus Paxillus stimul tammede kasvu..., kuigi 150 koopiat. Kontsert-evol. IGS palju informatiivsem kui allosüümid... DSE aatsiatega kaasa tulnud Rhizobiumid: IGS, nifD ja nodA fülogeneesi põhjal...); Peziza whitei ja Muciturbo (mõl MR); 2a Boudiera tracheia (MR); Plicaria alveolata... isolaatide haploidsus, kaupageenide kadumine kultiveerimise käigs %koloniseeritud vs kontaminant veestress: Cenococcum...õttu; mujalt tulev C ei indutseeri IGS RFLP meetod geneti määramiseks ECMs... alleelid. Paariline enamasti koniid ja v IGS RFLP meetod geneti määramiseks ECMs... eosed Trichaptum: mitu ITS ja IGS varianti. Dik org-s kummaski tuumas erinev ITS v IGS versioon. 85% juhtudest ITS1 ja..., mis erinevad suure indeli poolest. IGS sisald v palju mikrosatelliite, mis on... mõju puhaskultuuris Wilcoxina EeMR eluiga u 2a Soomes, nonMR juuretipul palju vähem... väärtus võib tuleneda kitiini lagundamisest IGS rekombineerub meioosis; IGS1 heteroduplekside moodustumine...



Дата загрузки: 2018-04-17
Скачать документ
Скачать текст
0.12/5
... Systems Service IF Ionosphere Free IGS International GNSS Service IGSO Inclined... efemérides é de cerca de 1.6 m [IGS, 2009]. Com o Acesso Selectivo (ver... por diferentes instituições, como o IGS (International GNSS Service), o NRCan (Natural... (Jet Propulsion Laboratory). Por exemplo, o IGS faculta quatro tipos de órbitas... exactidão superior a 5 cm [Yang, 2006; IGS, 2009]. Erros nos Relógios...ão de cerca de 7 nanosegundos (ns) [IGS, 2009] ou equivalentemente, de cerca... órbitas pós-processadas usualmente também disponibilizam. O IGS, por exemplo, juntamente com os... efemérides finais) [Yang, 2006; IGS, 2009]. Como abordagens alternativas pode... devidamente orientadas. De acordo com IGS [2008], recomenda-se que nas estações IGS apenas se instalem antenas que... obtidos a partir de dados do IGS. Cinco Centros de Análise... varia entre os 2 e os 8 TECU [IGS, 2009]. Uma alternativa a estes modelos..., estão descritas em Niell [2006]. O IGS disponibiliza um modelo troposférico... , é calculado usando [Frei, 1991] σ aˆij = q σ 2aˆi − 2σ aˆi σ aˆj + σ 2aˆj onde σ 2aˆi , σ 2aˆj , σ aˆi σ aˆj são obtidos de Qxˆ . Os... as efemérides finais do IGS. No caso do Galileo, o GNSSim... os resultados dos cenários 2A semelhantes ou melhores aos obtidos... University of Technology, Göteborg. IGS (2008). “IGS analysis center workshop 2008 recommendations.../ pubs/IGSWorkshop2008/docs/IGS08_recommendations.pdf IGS (2009). “IGS products.” International GNSS Service... (2001). “GPS precise positioning using IGS orbit products.” GPS Solutions, Vol...



Дата загрузки: 2017-09-25
Скачать документ
Скачать текст
0.08/5
... Social Science Quantitative Reasoning 1 ECON 2a Environmental Science 4,5 School of Science... HSSP HUM IIM IECS IEF IGS INET IMES ITAL JAPN JOUR...) Primarily for Undergraduate Students BISC 2a Human Reproduction, Population Explosion, Global... Capitalist Enterprise [ ss ] Prerequisite: ECON 2a (may be taken concurrently) or... of the Capitalist Enterprise ECON 2a Introduction to Economics Elective Courses...) Primarily for Undergraduate Students COSI 2a Introduction to Computers [ sn ] An...) Primarily for Undergraduate Students ECON 2a Introduction to Economics [ qr ss... China [ ss nw ] Prerequisite: ECON 2a. Analysis of China’s economic transformation... Environmental Economics [ ss ] Prerequisite: ECON 2a. Investigates the theoretical and policy... Asia’s Economies [ ss ] Prerequisite: ECON 2a. Examines the postwar economic performance... Analysis [ qr ss ] Prerequisite: ECON 2a. A first course in statistical inference... Management 166 Environmental Studies BISC 2a Human Reproduction, Population Explosion, Global... Health Economics [ ss ] Prerequisite: ECON 2a. Emphasizes the concepts and tools...: Science, Society, and Policy BISC 2a Human Reproduction, Population Explosion, Global... a Minor International and global studies (IGS) is an interdisciplinary program that... a deeper understanding of other cultures, IGS majors take one additional language... combination of the two). The IGS program thus combines a set of... faculty member teaching in the IGS program, but are encouraged to... specialization that they choose. Although IGS fulfills the university requirements as... studies curriculum. Students should take IGS 10a (Introduction to International and... (ECON 8b, Global Economy, or IGS 8a, Economic Principles and Globalization... for the Major A. Gateway course: IGS 10a (Introduction to International and Global Studies) A. Gateway course: IGS 10a (Introduction to International and...), ECON 8b (Global Economy) or IGS 8a (Economic Principles and Globalization...); ECON 8b (Global Economy) or IGS 8a (Economic Principles and Globalization... fulfill the requirements of the IGS minor must be taken for... the central issues of the IGS major. If extended international residence would be a hardship, IGS students may petition the IGS internship coordinator to... must receive permission of the IGS internship coordinator prior to starting... internship, and must enroll in IGS 89b (usually offered in the... (1–99) Primarily for Undergraduate Students IGS 8a Economic Principles and Globalization... ECON 2a and ECON 8b may not receive credit for IGS 8a... the courses counted toward the IGS major, and be engaged on a thesis project closely tied to IGS themes (as determined by the IGS honors coordinator). The student’s primary ... faculty member who teaches an IGS or IGS cross-listed course. The... one of whom teaches an IGS or IGS cross-listed course. Thesis students will register for IGS 99d (a fullyear course) with the... adviser. The first semester of IGS 99d may be used toward... requirement of two IGS electives (see requirement D, above). IGS departmental honors are... record in courses for the IGS major. H. No more than five... fulfill the requirements of the IGS major must be taken for...) and must be C or above. IGS 10a Introduction to International and.... Mr. Freeze or Mr. Ross IGS 89b Internship Seminar in International and Global Studies Prerequisite: IGS 10a. A weekly seminar combined with... course may count toward the IGS major requirement as an elective.... Usually offered every year. Staff IGS 92a Global Studies Internship This... offered only for non-IGS majors, or for IGS majors engaged in... been exempted from IGS 89b. Signature of the IGS internship coordinator is.... Usually offered every year. Staff IGS 98a Independent Study Usually offered every year. Staff IGS 98b Independent Study Usually offered every year. Staff IGS 99d Senior Research Seniors who... for degrees with honors in IGS must register for this course... ECON 8b The Global Economy IGS 8a Economic Principles and Globalization IGS 10a Introduction to International and ... BIOL 134b Tropical Ecology BISC 2a Human Reproduction, Population Explosion, Global... The Arts of Building Peace IGS 10a Introduction to International and...) Primarily for Undergraduate Students NEJS 2a Introduction to the Jewish Experience... The Sociology of Empowerment BISC 2a Human Reproduction, Population Explosion, Global... Undergraduate Singing [ ca ] Prerequisities: THA 2a or permission of instructor. May... Collaborative Process [ ca ] Prerequisites: THA 2a or permission of instructor. An... Design/Technical Practicum Prerequisites: THA 2a and 41a. Yields halfcourse credit... Stage Management Practicum Prerequisites: THA 2a and 41a. Yields halfcourse credit... Construction Fundamentals [ ca ] Prerequisite: THA 2a or permission of the instructor... Reproductive and Developmental Biology BISC 2a Human Reproduction, Population Explosion, Global... includes: Introduction to Economics (ECON 2a), Analysis of Economics Problems (ECON...



Дата загрузки: 2017-09-24
Скачать документ
Скачать текст
0.05/5
... Science Quantitative Reasoning Yes 1 ECON 2a Environmental Science 4,5 School of Science..., and Polilcy HUM IECS IEF IGS IIM INET IMES ITAL JAPN...) Primarily for Undergraduate Students BISC 2a Human Reproduction, Population Explosion, Global... Capitalist Enterprise [ ss ] Prerequisite: ECON 2a (may be taken concurrently) or... of the Capitalist Enterprise ECON 2a Introduction to Economics Elective Courses...) Primarily for Undergraduate Students COSI 2a Introduction to Computers [ sn ] An...-Computer Interaction [ sn ] Prerequisite: COSI 2a, or COSI 11a, or permission... Notes Relating to Undergraduates A . ECON 2a (Introduction to Economics) and ECON... Minor A. Successful completion of ECON 2a (Introduction to Economics) and ECON...) Primarily for Undergraduate Students ECON 2a Introduction to Economics [ qr ss... the Market [ ss ] Prerequisite: ECON 2a. Examines the strengths and limitations... Environmental Economics [ ss ] Prerequisite: ECON 2a. Investigates the theoretical and policy... of Education [ ss ] Prerequisite: ECON 2a. An introduction to economic analysis... Asia’s Economies [ ss ] Prerequisites: ECON 2a. Examines the post-war economic... ] Prerequisite: Successful completion of ECON 2a with a grade of C+ or higher... and Economics [ ss ] Prerequisite: ECON 2a. A study of economic foundations of... Labor Economics [ ss ] Prerequisite: ECON 2a. Topics include: Analysis of competitive... Analysis [ qr ss ] Prerequisite: ECON 2a. A first course in statistical inference...: The Role of Chemistry BISC 2a Human Reproduction, Population Explosion, Global... Policy BIOL 42a Physiology BISC 2a Human Reproduction, Population Explosion, Global... Minor International and global studies (IGS) is an interdisciplinary program that... a deeper understanding of other cultures, IGS majors take one additional language... combination of the two). The IGS program thus combines a set of... faculty member teaching in the IGS program, but are encouraged to... specialization that they choose. Although IGS fulfills the University requirements as... to International and Global Studies (IGS 10a) during their first or... (ECON 8b, Global Economy or IGS 8a, Economic Principles and Globalization... two sub-tracks) A. Gateway Course: IGS 10a (Introduction to International and...), ECON 8b (Global Economy) or IGS 8a (Economic Principles and Globalization... for the Minor A. Gateway Course: IGS 10a (Introduction to International and...), ECON 8b (Global Economy) or IGS 8a (Economic Principles and Globalization... the courses counted towards the IGS major, and be engaged on a thesis project closely tied to IGS themes (as determined by the IGS honors coordinator). The student’s primary ... faculty member who teaches an IGS or IGS cross-listed course. The... one of whom teaches an IGS or IGS cross-listed course. Thesis students will register for IGS 99d (a full-year course) with... advisor. The first semester of IGS 99d may be used towards... requirement of two IGS electives (See requirement D, above.) IGS departmental honors are... record in courses for the IGS major. H. No more than five... (1-99) Primarily for Undergraduate Students IGS 8a Economic Principles and Globalization... ECON 2a and ECON 8b may not receive credit for IGS 8a... offered every year. Mr. Coiner IGS 10a Introduction to International and.... Mr. Freeze and Mr. Ross IGS 92a Global Studies Internship Usually offered every year. Staff IGS 98a Independent Study Usually offered every year. Staff IGS 98b Independent Study Staff IGS 99d Senior Research... for degrees with honors in IGS must register for this course... ECON 8b The Global Economy IGS 8a Economic Principles and Globalization IGS 10a Introduction to International and ..., 1945 to the Present BISC 2a Human Reproduction, Population Explosion, Global... 132b, HIST 169a, HIST 179a, IGS 10a, NEJS 184a, PHIL 113b...) Primarily for Undergraduate Students NEJS 2a Introduction to the Jewish Experience... 144a Latin American Politics I BISC 2a Human Reproduction, Population Explosion, Global... honors. Required courses include: A. THA 2a Introduction to Theater Arts: From...-Physical Connection [ ca ] Prerequisite: THA 2a or permission of the instructor... Undergraduate Singing [ ca ] Prerequisities: THA 2a or permission of instructor. May... Collaborative Process [ ca ] Prerequisites: THA 2a or permission of instructor. An... Construction Fundamentals [ ca ] Prerequisite: THA 2a or permission of the instructor... 70a Directing [ ca ] Prerequisite: THA 2a or permission of instructor. Examines... Management: Part I [ ca ] Prerequisite: THA 2a or permission of the instructor... Musical Theater [ ca ] Prerequisite: THA 2a, or permission of the instructor... Costume Drafting [ ca ] Prerequisite: THA 2a or permission of the instructor... 109a Improvisation [ ca ] Prerequisite: THA 2a or permission of the instructor... the Camera [ ca ] Prerequisite: THA 2a or permission of instructor. A process... Reproductive and Developmental Biology BISC 2a Human Reproduction, Population Explosion, Global...



Дата загрузки: 2017-03-09
Скачать документ
Скачать текст
Скачать перевод
Посмотреть билингву
0.12/5
... wish to receive serious cases: – E.i.3.2a Results in Death – E.i.3.2b Life.../Number data element (G.k.2.1.1a, D.8.r.2a, D.10.8.r.3a) G.k.2.1.1a, D.8.r.2a, D.10.8.r.3a - MPID... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... be confirmed after ISO IDMP IGs are made available Business Rule... be confirmed after ISO IDMP IGs are made available Value Allowed... Text Business Rule(s) Mandatory if D.8.r.2a, D.10.8.r.2a, G.k.2.1.1a is populated Figure... (D.8.r.3a, D.10.8.r.3a, G.k.2.1.2a) D.8.r.3a, D.10.8.r.3a, G.k.2.1.2a - PhPID Version Date/Number... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... be confirmed after ISO IDMP IGs are made available Business Rule... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed...(s) Mandatory if D.8.r.3a, D.10.8.r.3a, G.k.2.1.2a is populated EU Individual Case... data element (D.8.r.EU.r.2a, D.10.8.r.EU.r.2a, G.k.2.3.r.2a) D.8.r.EU.r.2a, D.10.8.r.EU.r.2a, G.k.2.3.r.2a - Substance/Specified... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... be confirmed after ISO IDMP IGs are made available Business Rule... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... ISO IDMP IGs are made available Business Rule(s) Mandatory if G.k.2.3.r.2a is... be confirmed after ISO IDMP IGs are made available OID - Value... be confirmed after ISO IDMP IGs are made available Business Rule... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... be confirmed after ISO IDMP IGs are made available Business Rule... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... be confirmed after ISO IDMP IGs are made available Business Rule... requirements At least one of D.1, D.1.1.1,D.1.1.2, D.1.1.3,D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3,D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3. D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 ICH... (i.e. ‘CCYYMMDD’). At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5. See note 5 & 9 Mandatory... note 3 At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 ICH... CCYYMMDD (Minimum) Conditional-Mandatory ICH D.2.2a Age at Time of Onset... {Decade} Conditional-Mandatory Mandatory if D.2.2a is populated. See note 9 ICH... populated. At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 AN...-Mandatory At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5. See note 9 N - [0-6] - - - ICH... Text Optional Boolean - Optional AN D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 Minimum... Conditional-Mandatory EU D.8.r.1.EU.8 ICH D.8.r.2a ICH D.8.r.2b ICH D.8.r.3a ICH... / Specified Substance Name EU D.8.r.EU.r.2a Substance/Specified Substance TermID Version... is populated Mandatory if D.8.r.EU.r.2a is populated Mandatory if G.k.2.3.r.3b... Substance Name EU D.10.8.r.EU.r. 2a Substance/Specified Substance TermID Version... by the Reporter 1 N (1,2,3,4) Optional ICH E.i.3.2a Results in Death - Boolean - Mandatory... Must be the value 5 if E.i.3.2a = "True" Medical Confirmation by Healthcare... F.r.2.1 Test Name (free text) ICH F.r.2.2a ICH - - - Mandatory if F.r.2.2b or... G.k.1 ICH G.k.2.1.1a ICH G.k.2.1.1b ICH G.k.2.1.2a ICH G.k.2.1.2b ICH G.k.2.2 EU G.k.2.2.EU... G.k.2.1.2b is populated Mandatory if G.k.2.1.2a is populated - EU G.k.2.2.EU.9.r .1 Device... (repeat as necessary) ICH G.k.2.3.r.1 ICH G.k.2.3.r.2a ICH G.k.2.3.r.2b ICH G.k.2.3.r.3a Strength.../2013 - 250 - N Numeric Mandatory if G.k.2.3.r.2a is populated Mandatory if G.k.2.3.r.3b... AN Free Text Optional G.k.4.r.10.2a Route of Administration TermID Version... decimal point only. Mandatory if G.k.4.r.9.2a is populated. Mandatory if G.k.4.r.10... of Administration (free text) G.k.4.r.11.2a Parent Route of Administration TermID... Conditional-Mandatory Mandatory if G.k.4.r.11.2a is populated. - - - Mandatory if G.k.4.r.10... Primary Source 50 250 ICH G.k.7.r.2a ICH G.k.7.r.2b Indication (MedDRA code... only. See note 1 Mandatory if G.k.7.r.2a or G.k.7.r.1 is populated. See note...-Mandatory Mandatory if G.k.9.i.3.2a is populated N [1-4] Optional ICH G.k.9.i.3.2a ICH G.k.9.i.3.2b ICH... one of the following fields D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5. The use of...



Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
0.09/5
... a range of a few kilometres. Precise IGS orbits were used. When comparing....202 m) are shown below. Table 2a shows the correct values of... 2c. The values in Tables 2a and 2b show very small... of the kinematic positioning. Tab. 2a Correct double differences DDNW and... using L1 ambiguities in Table 2a 72209.24 72209.22 9:30... File: IGR, ESAG; Final File: IGS, CODG) Temp. Final Avg of... are not the final data (IGS, CODG) but the temporary data... orbits IGS and ionospheric delay estimates CODG are used time Fig. 2a... addition, GPS data from several IGS sites in China during the... PRN29 and PRN21 observed at IGS sites WUHN and BJFS respectively... connected to International GPS Service (IGS) network. The network records, distributes... River (01/09) Melb obs (IGS station) (18/11) Clayton (12... and 3-8mm in height using IGS final orbits products (Brown, 2002... ITRF, GDA, MGA grid, and IGS precise ephemeris, etc. Further investigation... by the International GPS Services (IGS, 2000). The deformation analysis can... GPSnet, relatively stable and precise IGS/ARGN reference stations close to..., the "Melbourne Observatory" station in IGS There are a number of different... a fixed datum derived from three IGS stations (HOB2,STR1,TIDB)is... network. Irymple TIDB (IGS) STR1 (IGS) Cann River IGS station HOB2 (IGS) Fig. 6 An... solution. AUSPOS processing engine uses IGS precise ephemeris products, Earth orientation... and differential technique to several IGS stations. The data processing is... Australian tectonic motion vector from IGS The total displacement magnitude "V" is... Figure 12) derived from other IGS measurements (Geoscience Australia, 2004b). Since... (11): 1035-1039. IGS (2000): International GPS Services (IGS) - International Terrestrial Reference... not relative) troposphere measurements, three IGS stations were included in the... available from BKG’s website (http://igs.ifag.de/ntrip_down.htm). 3.3 Using...-Wesley, Boston. Ntrip Homepage, http://igs.ifag.de/index_trip.htm. Radio... of 129 International GPS Service (IGS) sites across Europe for over... up components, respectively. The corresponding IGS SP3 final orbits were also... (4) into equation (2), we have n g = 1 − a1 / f 2 − 2a 2 / f 3 − 3a3 / f 4 (5) Wang et al.: Triple... (4) and (5) into equation (6) gives 2 293 − 2a 2 / f 3 − 3a3 / f 4 )ds (8) s ∫ ∫ ∫ s s s = − (a1 / f 2 )ds − 2 (a 2 / f 3 )ds...



Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
0.05/5
..., p. 106, f ig. 5; Gordon, 1984, p. 22, f igs. 3D–F; Cook, 1985, p. 196, figs... gigantea: Busk, 1856a, p. 93, pl. 5, f igs. 1–2. Busk, 1886, p. 39; Hincks, 1880a, p. 535, pl. 77, f igs. 3–4; 1887b, p. 128. Marcus, 1937, p. 131.... 7, f ig. 1; Harmer, 1915, p. 68, pl. 5, f igs. 6–7; Marcus, 1937, p. 134, pl. 27..., 1971, p. 488; Menon, 1972b, p. 612, f igs. 24–29; Winston, 1982, p. 110...; Marcus, 1937, p. 139, pl. 28, f igs. 75A–B. Zoobotryon verticillatum: Soule in..., 1963, p. 18; Menon, 1972b, p. 618, f igs. 35–37; Winston, 1982, p. 113.... 13; 1984, p. 6, f ig. 11; 2004, p. 7, f igs. 3–4; Bock, 1982, p. 333, f ig. 9.5c... Hincks, 1887b, p. 127, pl. 12, f igs. 9–13; Kirkpatrick, 1890b, p. 603; Harmer..., p. 203, pl. 1, figs. 1–11, pl. 2, f igs. 12–19; Rogick & Croasdale, 1949..., 1963, p. 20; Menon, 1972b, p. 624, f igs. 50–51. Material examinado Presente... Aetea anguina (Linnaeus, 1758) Prancha 2A–B, 3A Tabela 3 Sertularia anguina Anguinaria..., fig. 1; 1884, p. 2; Hincks, 1880a, p. 4, pl. 1, f igs. 4–5; Osburn, 1912, p. 220, pl. 21..., p. 345; Canu & Bassler, 1920, p. 179, f igs. 47A–C, pl. 32, figs. 2–3; Harmer, 1926, p. 194, pl. 13, f igs. 3–4; Hastings, 1930, p. 702; 1932, p. 408; 1943, p. 472, f igs. 57A–C; Marcus, 1937, p. 26, pl..., p. 5, pl. 1, f ig. 1; Bock, 1982, p. 341, f igs. 9.6d–f; Hay ward & Ry land.... 10; Osburn, 1940, p. 347, pl. 1, f igs. 9–11; Soule, 1959, p. 4.; Cook, 1968a, p. 137; Gordon, 1984, p. 39, pl. 8, f igs. E–F; 1986, p. 44; Fransen, 1986, p. 12..., p. 278; Rogick & Croasdale, 1949, p. 43, f igs. 1–3; Hay ward, 1971, p. 481; Winston...; Hay ward & McKinney, 2002, p. 14, f igs. 5A–C. Material examinado Presente estudo..., 1852b, p. 31; Hincks, 1880a, p. 8, pl. 1, f igs. 8–11, pl. 2, f ig. 3; Osburn, 1914...; Hay ward & McKinney , 2002, p. 14, f igs. 5D–F. ? Aetea truncata: Marcus, 1938a..., 1940, p. 349; 1950, p. 23, pl. 2, f igs. 4–6; Rogick & Croasdale, 1949, p. 63; Maturo..., p. 124; Hastings, 1930, p. 706, pl. 3, f igs. 9–10. Nitscheina tuberculata: Jellyella tuberculata..., 1963, p. 170; Cook, 1968b, p. 134, f igs. 6a–b; 1985, p. 89, f ig. 26B..., f ig. 33; Fransen, 1986, p. 14, f igs. 4a–c. Material examinado Presente estudo..., 1937, [in part] p. 37, pl. 6, f igs. 14A, E–F. [non figs. 14B–D]; ?Cook...; Dick, Tilbrook & Mawatari, 2006, p. 2209, f igs. 5A–B. Material examinado Presente estudo.... 4; Canu & Bassler, 1919, p. 82, pl. 2, f igs. 5–7; 1920, p. 196, pl. 82, figs..., p. 410; Marcus, 1939, p. 131, pl. 8, f igs. 9A–C; Lagaaij, 1963, p. 482, text...: Lev insen, 1909, p. 190, pl. 1, f igs. 13a–e; Cheetham, 1966, p. 48, f ig.... g; Fransen, 1986, p. 41, f igs. 14a–h; Winston, 2005, p. 10, f igs. 15–19. Material...–F, 10C Johnston, 1840, p. 272, f igs. 1–2; 1847, p. 372, f igs. 69–70; Busk, 1852b, p. 32, pl. 24, f igs. 4–5; Hincks, 1880a, p. 96, pl. 4, f igs. 8–10; Robertson, 1905..., p. 504, f ig. 1; Hastings, 1943, p. 361, f igs. 18A–D; Osburn, 1947, p. 20. Material...; Sav igny, 1817, pl. 11, f igs. 3 1–5 . Marcus, 1938a, p. 24, pl. 5, figs..., p. 243; Sav igny, 1817, pl. 8, f igs.4 Prancha 12D 1–5 . Pieper, 1881, p. 43, 47, pl. 2, f igs. 5–7. Kirkpatrick, 1888, p. 504. Harmer, 1926, p. 398, pl. 27, f igs. 3–4; Osburn, 1927, p. 126; 1940, p. 402..., pls. 10E–F; Fransen, 1986, p. 57, f igs. 10a–g; Tilbrook, Hay ward & Gordon, 2001, p. 52, f igs. 6A,C; Hay ward & McKinney , 2002, p. 26, f igs. 10E–F; Tilbrook, 2006, p. 65, plat...–F; Gluhak, Lewis & Popijac, 2007, p. 399, f igs 3A–B. Material examinado Presente estudo.... 4, f ig. 5. Osburn, 1940, p. 377, pl. 5, f igs. 40–41; 1950, p. 109, pl...; Soule, Soule & Chaney, 1999, p. 32, f igs. 48–50. Material examinado Presente..., p. 243; Sav igny, 1817, p. 13, f igs. 3 Cothurnicella deadala Chlidonia deadala: Chlidonia.... 3–5. MacGillivray , 1885, p. 35, pl. 108, f igs. 2–2b. Busk, 1884, p. 8, pl. 28..., 1968a, p. 154; Gordon, 1989a, p. 450, f igs. 4–8; Wyse Jackson & Spencer Jones, 1996, p. 407, f igs 6G–H. Material examinado Presente estudo...; Sav igny, 1817, pl. 13, f igs. 2 Prancha 15E–F 1–5 . Alysidium lafontii: Busk, 1852b, p. 14, pl. 14, f igs. 1–5. Catenaria lafontii: Harmer, 1902, p. 305...; Hay ward & McKinney, 2002, p. 40, f igs. 17D–F. Material examinado Presente estudo...; Sav igny, 1817, pl. 13, f igs. 1 Prancha 15A–B 1–5 . Marcus 1937, p. 76..., figs. 40A–B; 1938a, p.31, pl. 7, f igs. 17A–B; 1939, p. 113, pl. 8, f ig.... 174A–E; Osburn, 1940, p. 464, pl. 9, f igs. 78–79; Correa, 1947, p. 1. Vittaticella... Harmer, 1957, p. 772, pl. 50, f igs. 4–5,15; Lagaaij, 1963, p. 202, pl...–F; Gluhak, Lewis & Popijac, 2007, p. 412, f igs 17A–C. 73 Material examinado Presente.... 11B; Osburn, 1940, p. 462, pl. 9, f igs. 75–77; Winston, 1982, p. 152...; Cheetham, Sanner & Jackson, 2007, p. 67, f igs. 1.2, 30.1, 30.2. Material examinado Presente...–B; 1955, p. 297; Winston, 2005, p. 89, f igs. 247–256. Material examinado Presente.... 2–3; Marcus, 1939, p. 153, pl. 11, f igs. 20A–C; 1955: 303; Osburn, 1940...



Дата загрузки: 2017-12-10
Скачать документ
Скачать текст
0.27/5
... GRS80 HDOP IAG IERS IGGOS IGS IGSN71 IGeS ITRF97 KOH LLR... 6.12 Şekil 6.13 Şekil 7.1 Şekil 7.2a Elipsoidal (h) ve ortometrik (H) yükseklik......................................................... 2 Geometrik...ındaki GPS gözlem noktaları ve IGS istasyonları .......... 57 GPS ölçülerinin ba... konum duyarlığı (Çizelge 6.13) ..................... 75 IGS istasyonlarının koordinat ve konum duyarl... uzunlukları ve ölçme süreleri............................................ 55 IGS istasyonları (Boucher vd., 1999) ............................................................... 58... konum standart sapmaları (mm) ................................................................................................. 75 IGS noktalarının koordinat ve konum duyarl...ıkta) üzerinde gösterilir. Bu bilgiler IGS gibi analiz merkezleri tarafından... 4 saattir. Ankara ve yakın öteki IGS istasyonu verileri de değerlendirmeye... süreleri Çizelge 4.1’de verilmiştir. IGS Ankara Sürekli gözlem sitasyonu RF2...ındaki GPS gözlem noktaları ve IGS istasyonları Uygulama verileri Antalya-Samsun...çlarına etkisini incelemek için 4 IGS istasyonu; ANKR (Ankara/Türkiye), MATE... noktalar Şekil 6.1’te gösterilmiştir. IGS noktalarının koordinat ve hızları ITRF97... vd., 1999; Çizelge 6.1). 58 Çizelge 6.1 IGS istasyonları (Boucher vd., 1999) 1997... .0129 .0003 .0003 .0003 12734M008 IGS istasyonlarıyla birlikte tüm istasyonlarda veri... bölgesinin ortasında kalan Ankara IGS istasyonunda kampanyası süresince %100 ba... Gerçekleşmeyen Öngörülen IGS TUTGA Geçki (sabit) Ge... Gerçekleşen 40% 20% 0% IGS TUTGA Geçki (sabit) Ge...:00 8:00-12:00 NICO IGS 530 ≤ S ≤ 1360 km TUTGA 140...ğu bilinmektedir. Çizelge 6.1’de görüldüğü gibi IGS istasyonlarının konum hızları (0.5-2.5 cm/yıl) anlaml..., 1998) gözlem (O) dosyalarına dönüştürülmüş; IGS istasyonlarının gözlem verileri www.sopac... bilgiler çeşitli GPS analiz merkezleri (IGS, CODE, NGS) tarafından yakla... merkezleri arasındaki uzaklık esastır. IGS duyarlı yörüngeleri ve Bernese ise... yöne bağlı değişim çizelgesi, IGS kalibrasyon merkezlerince hazırlanmaktadır. Ayn...ılıkların olduğu görülebilir. IGS istasyonlarının değerlendirilmesinde IGS’nin kendi çizelgesi esas...ığından bu çalışmada da IGS anten faz merkezi ve de.... 701008 numaralı anten bilgileri bu IGS verilmediğinden değerlendirme NGS... geneline yayılmış 100’ün üzerindeki IGS istasyonunda toplanan veriler çeşitli analiz...şkin çalışmalar da yürütülmektedir. IGS istasyonlarının yerel çalışmalarda kullan... dahil edilebilir. Bu çalışmada IGS istasyonları arasındaki uzunlukların çok...