Спутник ДЗЗ. IGS R-2a. [Редактировать]

Космический аппарат IGS 1B это радиолокационный аппарат дистанционного зондирования Земли разработанный корпорацией Mitsubishi Electric.

Дополнительная классификация

#Наименования
1Страна оператор(владелец) - Япония
2Страна производитель - Япония
3Тип орбиты - НОО
4Тип оператора(владельца) - государственный
5Радиолокационные спутники ДЗЗ
6Все спутники ДЗЗ

Технические характеристики

#ХарактеристикаЗначение
1Масса, кг1200
2Разрешающая способность (радара), метра3

Экономические характеристики

#ХарактеристикаДата измеренияЗначение
1Стоимость (аппарат), млн. долл.2003-11-29512

Информация о неудачном запуске

#ХарактеристикаЗначение
1Космодром Танегасима
2Дата пуска2003-11-29
3Полезная нагрузка 1xIGS O-2a
4Полезная нагрузка 1xIGS R-2a
5Ракета-носитель 1xH2A2024

Найдено 533 документов по запросу «IGS R-2a». [Перейти к поиску]


Дата загрузки: 2017-06-14
Скачать документ
Скачать текст
0.09/5
... consistent with recombination. The coalescent IGS genealogy confirmed subdivision and showed... of the nuclear ribosomal repeat (IGS) was an especially useful locus... the previous study, the 4-kb IGS was subdivided into 10 smaller... in each region (Fig. 1). IGS 1a and 2a are on one side... break between recombination blocks, and IGS 9a and 10a are on... four selected subregions of the IGS, the EF-1α, and pLK44.11... aligned sequences from different loci, (e.g., IGS 1a, 2a, 9a, and 10a) into... not (P < 0.05). When Fig. 1. The IGS locus, showing primers NLF2 and... regions were used, e.g., IGS 1a-11b and IGS 2a-10b for the 5′ region... Primer Sequence (5′ – 3′)b IGS IGS-1a IGS-11b IGS-2a IGS-10b IGS-3b IGS-10a IGS-2b CTCTCACCAAGGCATTGAGC TACACTCACCTCACCGGTAG... identified previously in the Americas, IGS 9a-10a sequence (approximately 800... the 4 kb of the entire IGS analyzed by Carbone and Kohn... the only portion of the IGS common to the present and... G. Malvárez G. Malvárez Population 3-2a Population 3-3a a Population 3-3 Population 3-4a... from multilocus data set. The IGS DNA sequence was analyzed first.... The compatibility matrix for IGS1a, 2a, 9a, and10a revealed conflict (Fig... blocks previously detected in the IGS (10). Much of the conflict..., IGS 1a-2a (which still presents internal conflict, [Fig. 3B]) and IGS 9a.... From a total of 754 bp, IGS 9a-10a presented 43 variable... in the case of the IGS locus, the Snn statistic showed... compatibility matrices for the locus IGS, generated using SNAP Clade (Markwordt.... A, Compatibility matrix for the combined IGS 1a, 2a, 9a, and 10 sequence... C, Compatibility matrices for the IGS 1a-2a and IGS 9a-10a sequences, respectively... the one obtained for the IGS 9a-10. Despite the lower... the intralocus conflict in the IGS. Given the genetic isolation of... combined data set, only the IGS 9a-10a was used. The... loci generated using SNAP Map (3). A, IGS 9a-10a; B, EF-1α; and C, 44..., and Washington for the loci IGS 9a-10a, EF-1α, and 44.11 IGS EF-1α 44.11 California Ontario... using MDIV (42) for the IGS 9a-10a. A, California versus Ontario... in the population-level analysis, IGS, EF1-α, and 44.11. The..., compared with species lineages. The IGS was an especially rich source... of Sclerotinia (10). Only the IGS provided enough characters to differentiate... the Ontario sample. Both the IGS and 44.11 differentiated a Washington... subdivision, Snn. Polymorphisms in the IGS provided higher resolution than the... a different genotype; recombination within the IGS locus; and interlocus recombination (IA... Genetree (4,19) for the loci IGS 9a-10a, 44.11, and... the mutations in the genealogy. A, IGS 9a-10a; B, 44.11; and...- Fig. 8. A, Haplotype map for the IGS 9a-10a locus for the... for North America for locus IGS 9a-10a ON AB NC...



Дата загрузки: 2018-05-18
Скачать документ
Скачать текст
0.08/5
... - PDGS-116 Clarify name of igs antex file 09/10/2013... the ANTEX file generated by IGS: Start and End of frequency... quality reports IGS NTC GPS Orbits IGS NTC GPS Clocks IGS REP GPS... UNCLASSIFIED – For Official Use Description IGS REP GPS Clocks IERS Earth... reports IGS NTC GPS Orbits IGS NTC GPS Clocks IGS REP GPS Orbits IGS... Receiver Independent Exchange Format Reprocessed (IGS products) Rapid Orbit Ephemerides Root... - S2A, S2B (applicable to Sentinel 2A and Sentinel 2B), S2_ is... UNCLASSIFIED – For Official Use Sentinel-2A OPER AUX_PREORB UTC=2016-03... POD Restituted Orbit File Sentinel-2A OPER AUX_RESORB UTC=2016-03... Sentinel-## # indicates the spacecraft ID; 2A, 2B File_Class Variable Consistent with... orbits shall compare to the IGS final orbits with a 1D 1-sigma... clocks shall compare to the IGS final clocks with a sigma of... orbits shall compare to the IGS final orbits in 1D 1-sigma... clocks shall compare to the IGS final clocks in sigma better... orbits shall compare to the IGS final orbits with a 1D 1-sigma... clocks shall compare to the IGS final clocks with a sigma of... STC GPS products compared against IGS rapid products presented as daily... for 15M NRT vs. igr/igs Results for 24H NRT vs. igr/igs Results for 24H STC vs. igr/igs Where igr is for daily and weekly reports and igs for monthly reports 11.13....Z where: N is the number of IGS reprocessing campaign d: day of week... accuracy generated as part of IGS reprocessing campaigns 11.17.3 Dissemination....Z where: N is the number of IGS reprocessing campaign d: day of week...



Дата загрузки: 2018-05-05
Скачать документ
Скачать текст
0.16/5
...) ARVOL & CIV 2A, BATTY 2A & 3B ARRS KOK & NIK 2A, LNO 2A & 3B ARRS... AERODROME LANDING CHART NORVENICH & TABUM 2A, SIGEN 4A ARRS ARPEG 1N... RNAV DEP (OVERLAY) COLA & KUMIK 2A, GERMINGHAUSEN 7Z RNAV DEPS COLA... VFR AERODROME LANDING CHART ABERU 2A, KULOK 2A, TABAT 3A ARRS PEROX... AERODROME LANDING CHART NEMIX & OKAMO 2A RNAV ARRS NEMIX & OKAMO 2B... AREA CHART INFORMATION (CONT'D 3) KEGUN 2A, 2B, 2C & 1D ARRS TIPOD... 1, 1A, 1B & 1C DEPS SID 2, 2A, 3 & 4 DEPS AIRPORT, AIRPORT INFO, TAKE... 4) EELDE 1A & 1B, NORKU & REKKEN 2A & 2B ARRS DENUT, HELEN & PUTTY... LAMSO & REDFA 1A, MOLIX 2A ARRS TOPPA 2A ARR EELDE 1A & 1B... & REDFA 1A, MOLIX 2A NIGHT ARRS TOPPA 2A NIGHT ARR SID DESIGNATION... GENERAL AERODROME INFORMATION (CONT'D) PEGAM 2A & 2B COPTER DEPS AIRPORT, PARKING...-3 13-4 19-1 19-2 19-2A 10-2 10-2A 10-3 10-3A 10... (TEMP) CONSTRUCTION WORKS PHASE 1C & 2A (TEMP) CONSTRUCTION WORKS PHASE 2B... AERODROME LANDING CHART AKUMA & PELUT 2A ARRS AKUMA & PELUT 2B, IKAMU... RNAV ARRS (OVERLAY) DETIG & ELEKA 2A RNAV ARRS (OVERLAY) DETIG & ELEKA... ARRS MANUX, TIRIN, VALUV & XARIN 2A ARRS MANUX, TIRIN, VALUV & XARIN... MNM ALTS BERGRIVER 2A & 2B ARRS HOPEFIELD 2A & 2B ARRS BERGRIVER 1A..., OBOGA 1A & 7A ARRS MOKIR 2A, OBOGA 2A & 8A ARRS BENOV, KUDAX..., LAMAD, MADOV, NARMI, NOLRO & VAGNO 2A ARRS LAMAD, MADOV & NARMI 5A... & ZEMEN A & B DEPS MADER & SIDES 1A, 2A & B DEPS AIRPORT, AIRPORT INFO, TAKE... 35 (JET) ASTAR & LAKBE 2A, LUBAR 2A & 2V ARRS ASTAR, LAKBE & LUBAR 2B ARRS MANDA 2A, PARIM & TORBA 2A & 2V, RAGAS 2A ARRS MANDA, PARIM... APMES, LADAN, LOTAS, NAKURU & TILUK 2A RNAV ARRS APMES, LADAN, LOTAS... APT 10-1B 10-2 10-2A 10-2A-1 10-2B 10-2B... OKLA WESTHEIMER INDEX NUMBER 10-2A-1 10-2A-2 10-2B 10-2C... INDEX NUMBER APT 40-2 40-2A 40-2A-1 40-2B 40-2C... ALICANTE 4A, ASTRO 4F, NARGO 2A DEPS CONTINGENCY DEPS NOISE ABATEMENT... ARRS CBY 2A, DANBO 2A & 2B DEPS KOVAR, LTP & MEBAK 2A DEPS MURRO & PAS 2A DEPS ROMAM & VENAT 2A DEPS AIRPORT..., 22L ARRS ALEXANDROUPOLIS, CHRISOUPOLIS & KOROS 2A DEPS ALEXANDROUPOLIS, CHRISOUPOLIS & KOROS 2B... AERODROME LANDING CHART LARKI 2A, ORMOS & URNIL 2A & 1C ARRS LARKI 3B... 2C & 2E ARRS BRD 2A & 2B, ROBOT 2A ARRS BRD 5C & 5D..., GOKEL & TROTA 1A, ORSOM 2A ARRS DOLON 2A, ENOXA, FASAN & ROBOT 1A... 1S & 1T ARRS MOROB 2A & 1B, PELOS 2A & 2B ARRS REVDO 1A...-1 11-1A 11-2 CHART NAME IGS RWY 27 (NON PRECISION APCH... & 2V ARRS RCH, RIFEN 2A & 1B, TIBRO 2A & 2B ARRS LUPIN 6A..., AIRPORT INFO, TAKE-OFF MNMS IGS RWY 25 VFR APPROACH CHART... AIRPORT INFO, TAKE-OFF MNMS IGS RWY 01 LOC-HOTEL RWY... 4B ARRS BEO 4A, DEREG 2A, NERTA 2A & 2B ARRS BEO 5B... DEPS BEREL, BETIR, KATOK & PIXAR 2A DEPS BEREL, BETIR, KATOK & PIXAR... AIRPORT, PARKING SPOTS & COORDS HUATULCO 2A & 2B DEPS HUATULCO 2C & 2D...-OFF MNMS TMA DUVRO 2, LIDAK 2A & SALTILLO 2 DEPS IRBUR & URSEK 3 DEPS... MNMS TMA INDIO 1, KARIX 1, MOCHIS 2A, PERTI 1, TEKAS 1 DEPS ARENA 1, CAPUL... MNM ALTS AMOKI 2, AVRIK 2, LEON 2A & URVEM 2 DEPS AMOVA 2, ANILA 2C... MNMS TMA CAPAS 1, MEXICALI 2A, MULPA 1, ONDUM 2A DEPS MEXICALI 3B, NORAR... ALTS AVSAR, DATUL, KOBEK & TUMAL 2A ARRS AVSAR, DATUL, KOBEK & TUMAL... TMA AGAVE 2, BENAT 1, TAKAN 1, VSA 2A DEPS GRUTA 3, NUKAR 2, VSA 2B... RWY 21 NDB A CTA DABKA 2A, DROPT 2A & LAKES 1A RNAV ARRS... & 1F, RUDESHUR 2A & 4B ARRS SAVEH 2A & 1B, VARAMIN 2A & 3B ARRS KAHRIZAK... & 1D, RUDESHUR 2A & 4B ARRS SAVEH 2A & 1B, VARAMIN 2A & 3B ARRS DAXIL... DEPS RADAL 2A, 2B & 2C, RUDESHUR 2A & 2B DEPS SAVEH 2A, 2B & 3C... 1C, PUSAL 2C ARRS DATOL 2A, LABET 2A & 2B DEPS MODEK 1A... MNMS CIRCLING NDB BORES 2A ARR TABRIZ 2A & 2B DEPS AIRPORT, AIRPORT... 2A & 2B ARRS LOTAT 2A & 2B, MINAR 2 ARRS NAWABSHAH 2A & 2B ARRS BADIL 2A, 2B & 2C DEPS DANGI 2A & 2B DEPS MELOM 2A, 2B, 2D & 2E DEPS NANSI 2A & 2B, PUNAM 2A...-1 13-2 APT 10-2 10-2A 10-2A-1 10-2B 10-2B-1 10...-1 13-2 10-2 10-2-0 10-2A 10-2A-0 10-2B 10-2B-0 10...-17 11-17-0 11-2 11-2A 11-2A-0 11-2B 11-3 11... 1 ARRS ARITA 2A & 2B DEPS EXORA 2A & 2B DEPS KIBOK 2A & 2B DEPS... & 2D DEPS RAYAT 2A & 2B, RIANO 2A & 2B DEPS TADEL 2A & 2B DEPS... 2A, 2B, 2C & 2D DEPS COGEL 2A & 2B, GOSTO 2A & 2B DEPS MASUN 2A, 2B, 2C & 2D DEPS PARAL 2A, 2B, 2C & 2D DEPS PILAS 2A & 2B, TABUL 2A & 2B DEPS TANAL 2A & 2B DEPS TINDO 2A, 2B...-OFF MNMS ARRS GALIA 2A & 2B, ILOILO 2A & 2B DEPS KANON 2C... 2A & 2B DEPS MARAO 2A & 2B, NANAS 2A & 2B DEPS NASAG 2A & 2B, PALAY 2A... MNMS BACOLOD 2, BARBA 2 ARRS BUSOG 2A, CADIZ 1 ARRS REVISION DATE 27... 2A & 2B, BACON 2A & 2B DEPS BATAY 2A & 2B, BOHOL 2A & 2B DEPS COBOL 2A & 2B, DIMLO 2A & 2B DEPS KANON 2A & 2B, MOLOC 2A & 2B DEPS PARAO 2A & 2B, PONSO 2A & 2B DEPS TADAG 2A..., ILPAR, IMBOL & KONRI 2A ARRS PONPI, PUBER & SORTI 2A ARRS BITIS, ILPAR..., IMBOL, PUBER & SORTI 2A DEPS ILPAR, KONRI & PONPI 2A DEPS BITIS, IMBOL...



Дата загрузки: 2017-12-26
Скачать документ
Скачать текст
0.04/5
... Prometheus 1B – 2013-064E Prometheus 2A – 2013-064K Prometheus 2B – 2013...) – 2013-001C IGS 8A (IGS Radar 4) – 2013-002A IGS 8B (IGS Optical Demonstrator) -- 2013...-025D Nimiq 6 – 2012-026A Zhongxing 2A – 2012-028A Yaogan-15 – 2012... GOES-11 – 2000-022A BSAT-2A – 2001-011B ICO-F2 – 2001...-049A Arabsat-5C -- 2011-049B IGS-Optical 4 – 2011-050A Atlantic Bird...-074A Luch-5A – 2011-074B IGS-7A – 2011-075A ELISA-W23...-C – 2006-011C MIDstar-1 – 2007-006B IGS-4B – 2007-005B Egyptsat-1 – 2007... PakSat-1R – 2011-042A HaiYang 2A – 2011-043A EduSAT – 2011-044A...-035B AISSat 1 – 2010-035C Alsat 2A – 2010-035D TISat 1 – 2010-035E...-B – 2007-004B THEMIS-C – 2007-004C IGS-3B – 2007-005A Zheda Pixing...-064A Eutelsat W7 – 2009-065A IGS 5A – 2009-066A Intelsat 15...-019A GIOVE-B – 2008-020A CartoSat 2A – 2008-021A CAN-X6 – 2008...: LAPAN-Tubsat (2007-001A) CartoSat 2A (2007-001B) PehuenSat 1 (2007-001D...) THEMIS 5 (2007-004E) IGS 3B (2007-005A) IGS 4A (2007-005B) ASTRO...-043D) Cosmos 2388 (2002-017A) IGS-1B (2003-009B) Streak [STP... some satellite data Satellites Added: IGS-3A (Information Gathering Satellite 3A...-034A Spacenet-4 - 1991-028A Telecom 2A - 1991-084A UFO-3 (USA 104...



Дата загрузки: 2017-09-25
Скачать документ
Скачать текст
0.09/5
... Social Science Quantitative Reasoning 1 ECON 2a Environmental Science 4,5 School of Science... HSSP HUM IIM IECS IEF IGS INET IMES ITAL JAPN JOUR...) Primarily for Undergraduate Students BISC 2a Human Reproduction, Population Explosion, Global... Capitalist Enterprise [ ss ] Prerequisite: ECON 2a (may be taken concurrently) or... of the Capitalist Enterprise ECON 2a Introduction to Economics Elective Courses...) Primarily for Undergraduate Students COSI 2a Introduction to Computers [ sn ] An...) Primarily for Undergraduate Students ECON 2a Introduction to Economics [ qr ss... China [ ss nw ] Prerequisite: ECON 2a. Analysis of China’s economic transformation... Environmental Economics [ ss ] Prerequisite: ECON 2a. Investigates the theoretical and policy... Asia’s Economies [ ss ] Prerequisite: ECON 2a. Examines the postwar economic performance... Analysis [ qr ss ] Prerequisite: ECON 2a. A first course in statistical inference... Management 166 Environmental Studies BISC 2a Human Reproduction, Population Explosion, Global... Health Economics [ ss ] Prerequisite: ECON 2a. Emphasizes the concepts and tools...: Science, Society, and Policy BISC 2a Human Reproduction, Population Explosion, Global... a Minor International and global studies (IGS) is an interdisciplinary program that... a deeper understanding of other cultures, IGS majors take one additional language... combination of the two). The IGS program thus combines a set of... faculty member teaching in the IGS program, but are encouraged to... specialization that they choose. Although IGS fulfills the university requirements as... studies curriculum. Students should take IGS 10a (Introduction to International and... (ECON 8b, Global Economy, or IGS 8a, Economic Principles and Globalization... for the Major A. Gateway course: IGS 10a (Introduction to International and Global Studies) A. Gateway course: IGS 10a (Introduction to International and...), ECON 8b (Global Economy) or IGS 8a (Economic Principles and Globalization...); ECON 8b (Global Economy) or IGS 8a (Economic Principles and Globalization... fulfill the requirements of the IGS minor must be taken for... the central issues of the IGS major. If extended international residence would be a hardship, IGS students may petition the IGS internship coordinator to... must receive permission of the IGS internship coordinator prior to starting... internship, and must enroll in IGS 89b (usually offered in the... (1–99) Primarily for Undergraduate Students IGS 8a Economic Principles and Globalization... ECON 2a and ECON 8b may not receive credit for IGS 8a... the courses counted toward the IGS major, and be engaged on a thesis project closely tied to IGS themes (as determined by the IGS honors coordinator). The student’s primary ... faculty member who teaches an IGS or IGS cross-listed course. The... one of whom teaches an IGS or IGS cross-listed course. Thesis students will register for IGS 99d (a fullyear course) with the... adviser. The first semester of IGS 99d may be used toward... requirement of two IGS electives (see requirement D, above). IGS departmental honors are... record in courses for the IGS major. H. No more than five... fulfill the requirements of the IGS major must be taken for...) and must be C or above. IGS 10a Introduction to International and.... Mr. Freeze or Mr. Ross IGS 89b Internship Seminar in International and Global Studies Prerequisite: IGS 10a. A weekly seminar combined with... course may count toward the IGS major requirement as an elective.... Usually offered every year. Staff IGS 92a Global Studies Internship This... offered only for non-IGS majors, or for IGS majors engaged in... been exempted from IGS 89b. Signature of the IGS internship coordinator is.... Usually offered every year. Staff IGS 98a Independent Study Usually offered every year. Staff IGS 98b Independent Study Usually offered every year. Staff IGS 99d Senior Research Seniors who... for degrees with honors in IGS must register for this course... ECON 8b The Global Economy IGS 8a Economic Principles and Globalization IGS 10a Introduction to International and ... BIOL 134b Tropical Ecology BISC 2a Human Reproduction, Population Explosion, Global... The Arts of Building Peace IGS 10a Introduction to International and...) Primarily for Undergraduate Students NEJS 2a Introduction to the Jewish Experience... The Sociology of Empowerment BISC 2a Human Reproduction, Population Explosion, Global... Undergraduate Singing [ ca ] Prerequisities: THA 2a or permission of instructor. May... Collaborative Process [ ca ] Prerequisites: THA 2a or permission of instructor. An... Design/Technical Practicum Prerequisites: THA 2a and 41a. Yields halfcourse credit... Stage Management Practicum Prerequisites: THA 2a and 41a. Yields halfcourse credit... Construction Fundamentals [ ca ] Prerequisite: THA 2a or permission of the instructor... Reproductive and Developmental Biology BISC 2a Human Reproduction, Population Explosion, Global... includes: Introduction to Economics (ECON 2a), Analysis of Economics Problems (ECON...



Дата загрузки: 2017-09-24
Скачать документ
Скачать текст
0.06/5
... Science Quantitative Reasoning Yes 1 ECON 2a Environmental Science 4,5 School of Science..., and Polilcy HUM IECS IEF IGS IIM INET IMES ITAL JAPN...) Primarily for Undergraduate Students BISC 2a Human Reproduction, Population Explosion, Global... Capitalist Enterprise [ ss ] Prerequisite: ECON 2a (may be taken concurrently) or... of the Capitalist Enterprise ECON 2a Introduction to Economics Elective Courses...) Primarily for Undergraduate Students COSI 2a Introduction to Computers [ sn ] An...-Computer Interaction [ sn ] Prerequisite: COSI 2a, or COSI 11a, or permission... Notes Relating to Undergraduates A . ECON 2a (Introduction to Economics) and ECON... Minor A. Successful completion of ECON 2a (Introduction to Economics) and ECON...) Primarily for Undergraduate Students ECON 2a Introduction to Economics [ qr ss... the Market [ ss ] Prerequisite: ECON 2a. Examines the strengths and limitations... Environmental Economics [ ss ] Prerequisite: ECON 2a. Investigates the theoretical and policy... of Education [ ss ] Prerequisite: ECON 2a. An introduction to economic analysis... Asia’s Economies [ ss ] Prerequisites: ECON 2a. Examines the post-war economic... ] Prerequisite: Successful completion of ECON 2a with a grade of C+ or higher... and Economics [ ss ] Prerequisite: ECON 2a. A study of economic foundations of... Labor Economics [ ss ] Prerequisite: ECON 2a. Topics include: Analysis of competitive... Analysis [ qr ss ] Prerequisite: ECON 2a. A first course in statistical inference...: The Role of Chemistry BISC 2a Human Reproduction, Population Explosion, Global... Policy BIOL 42a Physiology BISC 2a Human Reproduction, Population Explosion, Global... Minor International and global studies (IGS) is an interdisciplinary program that... a deeper understanding of other cultures, IGS majors take one additional language... combination of the two). The IGS program thus combines a set of... faculty member teaching in the IGS program, but are encouraged to... specialization that they choose. Although IGS fulfills the University requirements as... to International and Global Studies (IGS 10a) during their first or... (ECON 8b, Global Economy or IGS 8a, Economic Principles and Globalization... two sub-tracks) A. Gateway Course: IGS 10a (Introduction to International and...), ECON 8b (Global Economy) or IGS 8a (Economic Principles and Globalization... for the Minor A. Gateway Course: IGS 10a (Introduction to International and...), ECON 8b (Global Economy) or IGS 8a (Economic Principles and Globalization... the courses counted towards the IGS major, and be engaged on a thesis project closely tied to IGS themes (as determined by the IGS honors coordinator). The student’s primary ... faculty member who teaches an IGS or IGS cross-listed course. The... one of whom teaches an IGS or IGS cross-listed course. Thesis students will register for IGS 99d (a full-year course) with... advisor. The first semester of IGS 99d may be used towards... requirement of two IGS electives (See requirement D, above.) IGS departmental honors are... record in courses for the IGS major. H. No more than five... (1-99) Primarily for Undergraduate Students IGS 8a Economic Principles and Globalization... ECON 2a and ECON 8b may not receive credit for IGS 8a... offered every year. Mr. Coiner IGS 10a Introduction to International and.... Mr. Freeze and Mr. Ross IGS 92a Global Studies Internship Usually offered every year. Staff IGS 98a Independent Study Usually offered every year. Staff IGS 98b Independent Study Staff IGS 99d Senior Research... for degrees with honors in IGS must register for this course... ECON 8b The Global Economy IGS 8a Economic Principles and Globalization IGS 10a Introduction to International and ..., 1945 to the Present BISC 2a Human Reproduction, Population Explosion, Global... 132b, HIST 169a, HIST 179a, IGS 10a, NEJS 184a, PHIL 113b...) Primarily for Undergraduate Students NEJS 2a Introduction to the Jewish Experience... 144a Latin American Politics I BISC 2a Human Reproduction, Population Explosion, Global... honors. Required courses include: A. THA 2a Introduction to Theater Arts: From...-Physical Connection [ ca ] Prerequisite: THA 2a or permission of the instructor... Undergraduate Singing [ ca ] Prerequisities: THA 2a or permission of instructor. May... Collaborative Process [ ca ] Prerequisites: THA 2a or permission of instructor. An... Construction Fundamentals [ ca ] Prerequisite: THA 2a or permission of the instructor... 70a Directing [ ca ] Prerequisite: THA 2a or permission of instructor. Examines... Management: Part I [ ca ] Prerequisite: THA 2a or permission of the instructor... Musical Theater [ ca ] Prerequisite: THA 2a, or permission of the instructor... Costume Drafting [ ca ] Prerequisite: THA 2a or permission of the instructor... 109a Improvisation [ ca ] Prerequisite: THA 2a or permission of the instructor... the Camera [ ca ] Prerequisite: THA 2a or permission of instructor. A process... Reproductive and Developmental Biology BISC 2a Human Reproduction, Population Explosion, Global...



Дата загрузки: 2018-04-17
Скачать документ
Скачать текст
0.08/5
...-term Inoc1; Russ1; repeated vs 2a Pisol1; järgi prescribed põlengud, Thel1... ascomycete eriisendid Guidot A, Lumini E, Debaud IGS J-C, RFLP Marmeisse meetod R. geneti 1999... Ranjard L, Poly F, Lata J-C, Mougel bakteriteC,(IGS) Thioulouse ja seente J, Nazaret (ITS... trees of Calycadenia (Compositae). 18S-IGS praimer Mol. Phyl. Evol. 10... wastewater. J. Microbiol. reoveebakterite Meth. 57: IGS: 79-93. palju varieeruvam ja...-amplified Tylospora fibrillosa: ITS and IGS IGS,regions ITS -kultuurist of ribosomal...; fibrillosa: 126: 525-532. ECM IGS, ITS väga-kultuurist vilets amplifitseering..., ent ECMst väga vilets PCR IGS; 1 RE vs ECM vs EMH... enamasti koniid ja väga lähedalt IGS RFLP meetod geneti määramiseks ECMs..., domin ka viljakehadena ISSR>RAPD>>>IGS Suillusele. 1 ISSR marker Tomentella (Thelephoraceae..., siiski korge heterosügootsus ITS, IGS, mtLSU, mtSSU, ISSR n structure of... ITS 91: ja 163-172. IGS varianti. Trichaptum: Dik org-s mitukummaski... Dik ITS org-s ITS ja IGS vkummaski IGS varianti. versioon. tuumas Dik85...-s erinev juhtudest kummaski ITS vITS1 IGS tu ybridization among cryptic species... RAPDPress, eri liikidele. New York. IGS varieeruvam kui ITS ynthase homologs... Phytol. 139: 341-352. Pisolithus IGS ja ITS võrdselt variabiilsed f the.... Verticillium: Res. 99: 257-266. IGS ca 1570 bp, 5S Verticillium: RNA pole IGS sellescapaigas; 1570 bp, madal 5S.... Ruumilise varieeruvuse arvestamine ökoloogias. bakterite (IGS) ja seente (ITS) ARISA=ARDRA.... Ecology 87: S3-S13. Frankia IGS primer F16S gtgggaccggcgattgggac roparaonea, a new... tuuma ja mt DNA põhjal (IGS vs CTB); liigiteket on mõjutanud..., pink Piloderma, pink, Paxillus osa: IGS, ITS -kultuurist -ei mingit erinevust... sp ja Entoloma abortivum il IGS-RFLP: Armillaria Jaapanis; eri Armillaria...: regionaalne ristviljastumine, lo u ITS ja IGS varianti. Dik org-s kummaski tuumas erinev ITS v IGS versioon. 85% juhtudest ITS1 ja..., mis erinevad suure indeli poolest. IGS sisald v palju mikrosatelliite, mis on... replitseeritud, regiooni pikkused bakterite tihti (IGS) väljaspooli ja seenteandmebaasides (ITS) ARISA... genoomide sarnasuse ruumiline autok terite (IGS) ja seente (ITS) ARISA=ARDRA..., piikide pikkuse kvantit arvestamine, bakterite (IGS) kergejavarieeruvus seente (ITS) replikaatide ARISA... d, pop-struktuur ja ekstinktsioonid Frankia IGS primer F16S gtgggaccggcgattgggac. BD ei... 8a vastu , Hebeloma ja thelephora <2a tammeistandikus Paxillus stimul tammede kasvu..., kuigi 150 koopiat. Kontsert-evol. IGS palju informatiivsem kui allosüümid... DSE aatsiatega kaasa tulnud Rhizobiumid: IGS, nifD ja nodA fülogeneesi põhjal...); Peziza whitei ja Muciturbo (mõl MR); 2a Boudiera tracheia (MR); Plicaria alveolata... isolaatide haploidsus, kaupageenide kadumine kultiveerimise käigs %koloniseeritud vs kontaminant veestress: Cenococcum...õttu; mujalt tulev C ei indutseeri IGS RFLP meetod geneti määramiseks ECMs... alleelid. Paariline enamasti koniid ja v IGS RFLP meetod geneti määramiseks ECMs... eosed Trichaptum: mitu ITS ja IGS varianti. Dik org-s kummaski tuumas erinev ITS v IGS versioon. 85% juhtudest ITS1 ja..., mis erinevad suure indeli poolest. IGS sisald v palju mikrosatelliite, mis on... mõju puhaskultuuris Wilcoxina EeMR eluiga u 2a Soomes, nonMR juuretipul palju vähem... väärtus võib tuleneda kitiini lagundamisest IGS rekombineerub meioosis; IGS1 heteroduplekside moodustumine...



Дата загрузки: 2018-04-17
Скачать документ
Скачать текст
0.1/5
... Systems Service IF Ionosphere Free IGS International GNSS Service IGSO Inclined... efemérides é de cerca de 1.6 m [IGS, 2009]. Com o Acesso Selectivo (ver... por diferentes instituições, como o IGS (International GNSS Service), o NRCan (Natural... (Jet Propulsion Laboratory). Por exemplo, o IGS faculta quatro tipos de órbitas... exactidão superior a 5 cm [Yang, 2006; IGS, 2009]. Erros nos Relógios...ão de cerca de 7 nanosegundos (ns) [IGS, 2009] ou equivalentemente, de cerca... órbitas pós-processadas usualmente também disponibilizam. O IGS, por exemplo, juntamente com os... efemérides finais) [Yang, 2006; IGS, 2009]. Como abordagens alternativas pode... devidamente orientadas. De acordo com IGS [2008], recomenda-se que nas estações IGS apenas se instalem antenas que... obtidos a partir de dados do IGS. Cinco Centros de Análise... varia entre os 2 e os 8 TECU [IGS, 2009]. Uma alternativa a estes modelos..., estão descritas em Niell [2006]. O IGS disponibiliza um modelo troposférico... , é calculado usando [Frei, 1991] σ aˆij = q σ 2aˆi − 2σ aˆi σ aˆj + σ 2aˆj onde σ 2aˆi , σ 2aˆj , σ aˆi σ aˆj são obtidos de Qxˆ . Os... as efemérides finais do IGS. No caso do Galileo, o GNSSim... os resultados dos cenários 2A semelhantes ou melhores aos obtidos... University of Technology, Göteborg. IGS (2008). “IGS analysis center workshop 2008 recommendations.../ pubs/IGSWorkshop2008/docs/IGS08_recommendations.pdf IGS (2009). “IGS products.” International GNSS Service... (2001). “GPS precise positioning using IGS orbit products.” GPS Solutions, Vol...



Дата загрузки: 2017-03-09
Скачать документ
Скачать текст
Скачать перевод
Посмотреть билингву
0.12/5
... wish to receive serious cases: – E.i.3.2a Results in Death – E.i.3.2b Life.../Number data element (G.k.2.1.1a, D.8.r.2a, D.10.8.r.3a) G.k.2.1.1a, D.8.r.2a, D.10.8.r.3a - MPID... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... be confirmed after ISO IDMP IGs are made available Business Rule... be confirmed after ISO IDMP IGs are made available Value Allowed... Text Business Rule(s) Mandatory if D.8.r.2a, D.10.8.r.2a, G.k.2.1.1a is populated Figure... (D.8.r.3a, D.10.8.r.3a, G.k.2.1.2a) D.8.r.3a, D.10.8.r.3a, G.k.2.1.2a - PhPID Version Date/Number... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... be confirmed after ISO IDMP IGs are made available Business Rule... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed...(s) Mandatory if D.8.r.3a, D.10.8.r.3a, G.k.2.1.2a is populated EU Individual Case... data element (D.8.r.EU.r.2a, D.10.8.r.EU.r.2a, G.k.2.3.r.2a) D.8.r.EU.r.2a, D.10.8.r.EU.r.2a, G.k.2.3.r.2a - Substance/Specified... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... be confirmed after ISO IDMP IGs are made available Business Rule... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... ISO IDMP IGs are made available Business Rule(s) Mandatory if G.k.2.3.r.2a is... be confirmed after ISO IDMP IGs are made available OID - Value... be confirmed after ISO IDMP IGs are made available Business Rule... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... be confirmed after ISO IDMP IGs are made available Business Rule... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... be confirmed after ISO IDMP IGs are made available Business Rule... requirements At least one of D.1, D.1.1.1,D.1.1.2, D.1.1.3,D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3,D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3. D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 ICH... (i.e. ‘CCYYMMDD’). At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5. See note 5 & 9 Mandatory... note 3 At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 ICH... CCYYMMDD (Minimum) Conditional-Mandatory ICH D.2.2a Age at Time of Onset... {Decade} Conditional-Mandatory Mandatory if D.2.2a is populated. See note 9 ICH... populated. At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 AN...-Mandatory At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5. See note 9 N - [0-6] - - - ICH... Text Optional Boolean - Optional AN D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 Minimum... Conditional-Mandatory EU D.8.r.1.EU.8 ICH D.8.r.2a ICH D.8.r.2b ICH D.8.r.3a ICH... / Specified Substance Name EU D.8.r.EU.r.2a Substance/Specified Substance TermID Version... is populated Mandatory if D.8.r.EU.r.2a is populated Mandatory if G.k.2.3.r.3b... Substance Name EU D.10.8.r.EU.r. 2a Substance/Specified Substance TermID Version... by the Reporter 1 N (1,2,3,4) Optional ICH E.i.3.2a Results in Death - Boolean - Mandatory... Must be the value 5 if E.i.3.2a = "True" Medical Confirmation by Healthcare... F.r.2.1 Test Name (free text) ICH F.r.2.2a ICH - - - Mandatory if F.r.2.2b or... G.k.1 ICH G.k.2.1.1a ICH G.k.2.1.1b ICH G.k.2.1.2a ICH G.k.2.1.2b ICH G.k.2.2 EU G.k.2.2.EU... G.k.2.1.2b is populated Mandatory if G.k.2.1.2a is populated - EU G.k.2.2.EU.9.r .1 Device... (repeat as necessary) ICH G.k.2.3.r.1 ICH G.k.2.3.r.2a ICH G.k.2.3.r.2b ICH G.k.2.3.r.3a Strength.../2013 - 250 - N Numeric Mandatory if G.k.2.3.r.2a is populated Mandatory if G.k.2.3.r.3b... AN Free Text Optional G.k.4.r.10.2a Route of Administration TermID Version... decimal point only. Mandatory if G.k.4.r.9.2a is populated. Mandatory if G.k.4.r.10... of Administration (free text) G.k.4.r.11.2a Parent Route of Administration TermID... Conditional-Mandatory Mandatory if G.k.4.r.11.2a is populated. - - - Mandatory if G.k.4.r.10... Primary Source 50 250 ICH G.k.7.r.2a ICH G.k.7.r.2b Indication (MedDRA code... only. See note 1 Mandatory if G.k.7.r.2a or G.k.7.r.1 is populated. See note...-Mandatory Mandatory if G.k.9.i.3.2a is populated N [1-4] Optional ICH G.k.9.i.3.2a ICH G.k.9.i.3.2b ICH... one of the following fields D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5. The use of...



Дата загрузки: 2018-05-18
Скачать документ
Скачать текст
0.29/5
..., as is shown in Figure 2a, covered the spectrum of all... board and antenna. See Fig. 2a for some specifications. Two different... rms 0.15 cm rms Figure 2a: Novatel Smart and Smart-V1G... of the International Geospatial Society (IGS). GSDI Board of Directors ? achieve... advisory council and President of IGS Additionally, the GSDI Association through... and V. Pres International Geospatial Society (IGS) Individuals qualifying under Art IV... Service) URL: http://www.igs.org IGS provides important data and products...