Спутник ДЗЗ. IGS R-2a. [Редактировать]

Космический аппарат IGS 1B это радиолокационный аппарат дистанционного зондирования Земли разработанный корпорацией Mitsubishi Electric.

Дополнительная классификация

#Наименования
1Страна оператор(владелец) - Япония
2Страна производитель - Япония
3Тип орбиты - НОО
4Тип оператора(владельца) - государственный
5Радиолокационные спутники ДЗЗ
6Все спутники ДЗЗ

Технические характеристики

#ХарактеристикаЗначение
1Масса, кг1200
2Разрешающая способность (радара), метра3

Экономические характеристики

#ХарактеристикаДата измеренияЗначение
1Стоимость (аппарат), млн. долл.2003-11-29512

Информация о неудачном запуске

#ХарактеристикаЗначение
1Космодром Танегасима
2Дата пуска2003-11-29
3Полезная нагрузка 1xIGS O-2a
4Полезная нагрузка 1xIGS R-2a
5Ракета-носитель 1xH2A2024

Найдено 511 документов по запросу «IGS R-2a». [Перейти к поиску]


Дата загрузки: 2017-06-14
Скачать документ
Скачать текст
0.08/5
... consistent with recombination. The coalescent IGS genealogy confirmed subdivision and showed... of the nuclear ribosomal repeat (IGS) was an especially useful locus... the previous study, the 4-kb IGS was subdivided into 10 smaller... in each region (Fig. 1). IGS 1a and 2a are on one side... break between recombination blocks, and IGS 9a and 10a are on... four selected subregions of the IGS, the EF-1α, and pLK44.11... aligned sequences from different loci, (e.g., IGS 1a, 2a, 9a, and 10a) into... not (P < 0.05). When Fig. 1. The IGS locus, showing primers NLF2 and... regions were used, e.g., IGS 1a-11b and IGS 2a-10b for the 5′ region... Primer Sequence (5′ – 3′)b IGS IGS-1a IGS-11b IGS-2a IGS-10b IGS-3b IGS-10a IGS-2b CTCTCACCAAGGCATTGAGC TACACTCACCTCACCGGTAG... identified previously in the Americas, IGS 9a-10a sequence (approximately 800... the 4 kb of the entire IGS analyzed by Carbone and Kohn... the only portion of the IGS common to the present and... G. Malvárez G. Malvárez Population 3-2a Population 3-3a a Population 3-3 Population 3-4a... from multilocus data set. The IGS DNA sequence was analyzed first.... The compatibility matrix for IGS1a, 2a, 9a, and10a revealed conflict (Fig... blocks previously detected in the IGS (10). Much of the conflict..., IGS 1a-2a (which still presents internal conflict, [Fig. 3B]) and IGS 9a.... From a total of 754 bp, IGS 9a-10a presented 43 variable... in the case of the IGS locus, the Snn statistic showed... compatibility matrices for the locus IGS, generated using SNAP Clade (Markwordt.... A, Compatibility matrix for the combined IGS 1a, 2a, 9a, and 10 sequence... C, Compatibility matrices for the IGS 1a-2a and IGS 9a-10a sequences, respectively... the one obtained for the IGS 9a-10. Despite the lower... the intralocus conflict in the IGS. Given the genetic isolation of... combined data set, only the IGS 9a-10a was used. The... loci generated using SNAP Map (3). A, IGS 9a-10a; B, EF-1α; and C, 44..., and Washington for the loci IGS 9a-10a, EF-1α, and 44.11 IGS EF-1α 44.11 California Ontario... using MDIV (42) for the IGS 9a-10a. A, California versus Ontario... in the population-level analysis, IGS, EF1-α, and 44.11. The..., compared with species lineages. The IGS was an especially rich source... of Sclerotinia (10). Only the IGS provided enough characters to differentiate... the Ontario sample. Both the IGS and 44.11 differentiated a Washington... subdivision, Snn. Polymorphisms in the IGS provided higher resolution than the... a different genotype; recombination within the IGS locus; and interlocus recombination (IA... Genetree (4,19) for the loci IGS 9a-10a, 44.11, and... the mutations in the genealogy. A, IGS 9a-10a; B, 44.11; and...- Fig. 8. A, Haplotype map for the IGS 9a-10a locus for the... for North America for locus IGS 9a-10a ON AB NC...



Дата загрузки: 2017-12-26
Скачать документ
Скачать текст
0.03/5
... Prometheus 1B – 2013-064E Prometheus 2A – 2013-064K Prometheus 2B – 2013...) – 2013-001C IGS 8A (IGS Radar 4) – 2013-002A IGS 8B (IGS Optical Demonstrator) -- 2013...-025D Nimiq 6 – 2012-026A Zhongxing 2A – 2012-028A Yaogan-15 – 2012... GOES-11 – 2000-022A BSAT-2A – 2001-011B ICO-F2 – 2001...-049A Arabsat-5C -- 2011-049B IGS-Optical 4 – 2011-050A Atlantic Bird...-074A Luch-5A – 2011-074B IGS-7A – 2011-075A ELISA-W23...-C – 2006-011C MIDstar-1 – 2007-006B IGS-4B – 2007-005B Egyptsat-1 – 2007... PakSat-1R – 2011-042A HaiYang 2A – 2011-043A EduSAT – 2011-044A...-035B AISSat 1 – 2010-035C Alsat 2A – 2010-035D TISat 1 – 2010-035E...-B – 2007-004B THEMIS-C – 2007-004C IGS-3B – 2007-005A Zheda Pixing...-064A Eutelsat W7 – 2009-065A IGS 5A – 2009-066A Intelsat 15...-019A GIOVE-B – 2008-020A CartoSat 2A – 2008-021A CAN-X6 – 2008...: LAPAN-Tubsat (2007-001A) CartoSat 2A (2007-001B) PehuenSat 1 (2007-001D...) THEMIS 5 (2007-004E) IGS 3B (2007-005A) IGS 4A (2007-005B) ASTRO...-043D) Cosmos 2388 (2002-017A) IGS-1B (2003-009B) Streak [STP... some satellite data Satellites Added: IGS-3A (Information Gathering Satellite 3A...-034A Spacenet-4 - 1991-028A Telecom 2A - 1991-084A UFO-3 (USA 104...



Дата загрузки: 2017-12-26
Скачать документ
Скачать текст
0.05/5
... P5) Cartosat 2 (IRS P7) Cartosat 2A Cartosat 2B 1 1 Pleiades 1A Pleiades 1B Helios 2A Helios 2B SPOT 5 SPOT 6 SAR...їна DLR, TerraSAR X Німеччина Cabinet IGS Satellite (Information Intelligence Gathering Center... чисельність угруповання 1 IGS 3A IGS 5A IGS 6A (IGS O 4) IGS 8B IGS R 3 IGS 8A Максимальна Робочий...ічі на добу (опівдні / у ніч) 1,5 год. IGS Radar Spare 1,0 – – + – OFEQ 5 OFEQ 7 OFEQ... Mission (Канада), TerraSAR X2 (Німеччина), IGS Radar Spare (Японія) та ін. Анал...



Дата загрузки: 2017-09-25
Скачать документ
Скачать текст
0.07/5
... Social Science Quantitative Reasoning 1 ECON 2a Environmental Science 4,5 School of Science... HSSP HUM IIM IECS IEF IGS INET IMES ITAL JAPN JOUR...) Primarily for Undergraduate Students BISC 2a Human Reproduction, Population Explosion, Global... Capitalist Enterprise [ ss ] Prerequisite: ECON 2a (may be taken concurrently) or... of the Capitalist Enterprise ECON 2a Introduction to Economics Elective Courses...) Primarily for Undergraduate Students COSI 2a Introduction to Computers [ sn ] An...) Primarily for Undergraduate Students ECON 2a Introduction to Economics [ qr ss... China [ ss nw ] Prerequisite: ECON 2a. Analysis of China’s economic transformation... Environmental Economics [ ss ] Prerequisite: ECON 2a. Investigates the theoretical and policy... Asia’s Economies [ ss ] Prerequisite: ECON 2a. Examines the postwar economic performance... Analysis [ qr ss ] Prerequisite: ECON 2a. A first course in statistical inference... Management 166 Environmental Studies BISC 2a Human Reproduction, Population Explosion, Global... Health Economics [ ss ] Prerequisite: ECON 2a. Emphasizes the concepts and tools...: Science, Society, and Policy BISC 2a Human Reproduction, Population Explosion, Global... a Minor International and global studies (IGS) is an interdisciplinary program that... a deeper understanding of other cultures, IGS majors take one additional language... combination of the two). The IGS program thus combines a set of... faculty member teaching in the IGS program, but are encouraged to... specialization that they choose. Although IGS fulfills the university requirements as... studies curriculum. Students should take IGS 10a (Introduction to International and... (ECON 8b, Global Economy, or IGS 8a, Economic Principles and Globalization... for the Major A. Gateway course: IGS 10a (Introduction to International and Global Studies) A. Gateway course: IGS 10a (Introduction to International and...), ECON 8b (Global Economy) or IGS 8a (Economic Principles and Globalization...); ECON 8b (Global Economy) or IGS 8a (Economic Principles and Globalization... fulfill the requirements of the IGS minor must be taken for... the central issues of the IGS major. If extended international residence would be a hardship, IGS students may petition the IGS internship coordinator to... must receive permission of the IGS internship coordinator prior to starting... internship, and must enroll in IGS 89b (usually offered in the... (1–99) Primarily for Undergraduate Students IGS 8a Economic Principles and Globalization... ECON 2a and ECON 8b may not receive credit for IGS 8a... the courses counted toward the IGS major, and be engaged on a thesis project closely tied to IGS themes (as determined by the IGS honors coordinator). The student’s primary ... faculty member who teaches an IGS or IGS cross-listed course. The... one of whom teaches an IGS or IGS cross-listed course. Thesis students will register for IGS 99d (a fullyear course) with the... adviser. The first semester of IGS 99d may be used toward... requirement of two IGS electives (see requirement D, above). IGS departmental honors are... record in courses for the IGS major. H. No more than five... fulfill the requirements of the IGS major must be taken for...) and must be C or above. IGS 10a Introduction to International and.... Mr. Freeze or Mr. Ross IGS 89b Internship Seminar in International and Global Studies Prerequisite: IGS 10a. A weekly seminar combined with... course may count toward the IGS major requirement as an elective.... Usually offered every year. Staff IGS 92a Global Studies Internship This... offered only for non-IGS majors, or for IGS majors engaged in... been exempted from IGS 89b. Signature of the IGS internship coordinator is.... Usually offered every year. Staff IGS 98a Independent Study Usually offered every year. Staff IGS 98b Independent Study Usually offered every year. Staff IGS 99d Senior Research Seniors who... for degrees with honors in IGS must register for this course... ECON 8b The Global Economy IGS 8a Economic Principles and Globalization IGS 10a Introduction to International and ... BIOL 134b Tropical Ecology BISC 2a Human Reproduction, Population Explosion, Global... The Arts of Building Peace IGS 10a Introduction to International and...) Primarily for Undergraduate Students NEJS 2a Introduction to the Jewish Experience... The Sociology of Empowerment BISC 2a Human Reproduction, Population Explosion, Global... Undergraduate Singing [ ca ] Prerequisities: THA 2a or permission of instructor. May... Collaborative Process [ ca ] Prerequisites: THA 2a or permission of instructor. An... Design/Technical Practicum Prerequisites: THA 2a and 41a. Yields halfcourse credit... Stage Management Practicum Prerequisites: THA 2a and 41a. Yields halfcourse credit... Construction Fundamentals [ ca ] Prerequisite: THA 2a or permission of the instructor... Reproductive and Developmental Biology BISC 2a Human Reproduction, Population Explosion, Global... includes: Introduction to Economics (ECON 2a), Analysis of Economics Problems (ECON...



Дата загрузки: 2017-12-26
Скачать документ
Скачать текст
0.03/5
... 1 launch vehicle with the STSAT 2A satellite. All 51 of the... • One South Korean payload: STSAT 2A. • 11 • Federal Aviation Administration / Commercial...: Helios 2B; • One Japanese payload: IGS Optical 3; • One Indian payload: Risat... March 4C Long March 3B H 2A H 2B PSLV Taepodong 2 KSLV-1 Safir... November and placed the military IGS Optical 3 reconnaissance satellite into orbit... the payload, the scientific STSAT 2A satellite, was not placed into... USA Intelligence S S 23-Jan-09 H 2A 202 Tanegashima SDS-1 GOSAT SSO... Communications Commercial Space Systems S S S S STSAT 2A LEO KARI KARI F F V Denotes commercial... Communications $125 M S S 28-Nov-09 H 2A 2024 01-Dec-09 V Zenit... Intelsat Orbital Sciences Corp. S S Baikonur IGS Optical 3 * Intelsat 15 V Denotes commercial...



Дата загрузки: 2017-12-26
Скачать документ
Скачать текст
0.03/5
... 1 launch vehicle with the STSAT 2A satellite. All 51 of the... • One South Korean payload: STSAT 2A. • 11 • Federal Aviation Administration / Commercial...: Helios 2B; • One Japanese payload: IGS Optical 3; • One Indian payload: Risat... March 4C Long March 3B H 2A H 2B PSLV Taepodong 2 KSLV-1 Safir... November and placed the military IGS Optical 3 reconnaissance satellite into orbit... the payload, the scientific STSAT 2A satellite, was not placed into... USA Intelligence S S 23-Jan-09 H 2A 202 Tanegashima SDS-1 GOSAT SSO... Communications Commercial Space Systems S S S S STSAT 2A LEO KARI KARI F F V Denotes commercial... Communications $125 M S S 28-Nov-09 H 2A 2024 01-Dec-09 V Zenit... Intelsat Orbital Sciences Corp. S S Baikonur IGS Optical 3 * Intelsat 15 V Denotes commercial...



Дата загрузки: 2017-09-24
Скачать документ
Скачать текст
0.05/5
... Science Quantitative Reasoning Yes 1 ECON 2a Environmental Science 4,5 School of Science..., and Polilcy HUM IECS IEF IGS IIM INET IMES ITAL JAPN...) Primarily for Undergraduate Students BISC 2a Human Reproduction, Population Explosion, Global... Capitalist Enterprise [ ss ] Prerequisite: ECON 2a (may be taken concurrently) or... of the Capitalist Enterprise ECON 2a Introduction to Economics Elective Courses...) Primarily for Undergraduate Students COSI 2a Introduction to Computers [ sn ] An...-Computer Interaction [ sn ] Prerequisite: COSI 2a, or COSI 11a, or permission... Notes Relating to Undergraduates A . ECON 2a (Introduction to Economics) and ECON... Minor A. Successful completion of ECON 2a (Introduction to Economics) and ECON...) Primarily for Undergraduate Students ECON 2a Introduction to Economics [ qr ss... the Market [ ss ] Prerequisite: ECON 2a. Examines the strengths and limitations... Environmental Economics [ ss ] Prerequisite: ECON 2a. Investigates the theoretical and policy... of Education [ ss ] Prerequisite: ECON 2a. An introduction to economic analysis... Asia’s Economies [ ss ] Prerequisites: ECON 2a. Examines the post-war economic... ] Prerequisite: Successful completion of ECON 2a with a grade of C+ or higher... and Economics [ ss ] Prerequisite: ECON 2a. A study of economic foundations of... Labor Economics [ ss ] Prerequisite: ECON 2a. Topics include: Analysis of competitive... Analysis [ qr ss ] Prerequisite: ECON 2a. A first course in statistical inference...: The Role of Chemistry BISC 2a Human Reproduction, Population Explosion, Global... Policy BIOL 42a Physiology BISC 2a Human Reproduction, Population Explosion, Global... Minor International and global studies (IGS) is an interdisciplinary program that... a deeper understanding of other cultures, IGS majors take one additional language... combination of the two). The IGS program thus combines a set of... faculty member teaching in the IGS program, but are encouraged to... specialization that they choose. Although IGS fulfills the University requirements as... to International and Global Studies (IGS 10a) during their first or... (ECON 8b, Global Economy or IGS 8a, Economic Principles and Globalization... two sub-tracks) A. Gateway Course: IGS 10a (Introduction to International and...), ECON 8b (Global Economy) or IGS 8a (Economic Principles and Globalization... for the Minor A. Gateway Course: IGS 10a (Introduction to International and...), ECON 8b (Global Economy) or IGS 8a (Economic Principles and Globalization... the courses counted towards the IGS major, and be engaged on a thesis project closely tied to IGS themes (as determined by the IGS honors coordinator). The student’s primary ... faculty member who teaches an IGS or IGS cross-listed course. The... one of whom teaches an IGS or IGS cross-listed course. Thesis students will register for IGS 99d (a full-year course) with... advisor. The first semester of IGS 99d may be used towards... requirement of two IGS electives (See requirement D, above.) IGS departmental honors are... record in courses for the IGS major. H. No more than five... (1-99) Primarily for Undergraduate Students IGS 8a Economic Principles and Globalization... ECON 2a and ECON 8b may not receive credit for IGS 8a... offered every year. Mr. Coiner IGS 10a Introduction to International and.... Mr. Freeze and Mr. Ross IGS 92a Global Studies Internship Usually offered every year. Staff IGS 98a Independent Study Usually offered every year. Staff IGS 98b Independent Study Staff IGS 99d Senior Research... for degrees with honors in IGS must register for this course... ECON 8b The Global Economy IGS 8a Economic Principles and Globalization IGS 10a Introduction to International and ..., 1945 to the Present BISC 2a Human Reproduction, Population Explosion, Global... 132b, HIST 169a, HIST 179a, IGS 10a, NEJS 184a, PHIL 113b...) Primarily for Undergraduate Students NEJS 2a Introduction to the Jewish Experience... 144a Latin American Politics I BISC 2a Human Reproduction, Population Explosion, Global... honors. Required courses include: A. THA 2a Introduction to Theater Arts: From...-Physical Connection [ ca ] Prerequisite: THA 2a or permission of the instructor... Undergraduate Singing [ ca ] Prerequisities: THA 2a or permission of instructor. May... Collaborative Process [ ca ] Prerequisites: THA 2a or permission of instructor. An... Construction Fundamentals [ ca ] Prerequisite: THA 2a or permission of the instructor... 70a Directing [ ca ] Prerequisite: THA 2a or permission of instructor. Examines... Management: Part I [ ca ] Prerequisite: THA 2a or permission of the instructor... Musical Theater [ ca ] Prerequisite: THA 2a, or permission of the instructor... Costume Drafting [ ca ] Prerequisite: THA 2a or permission of the instructor... 109a Improvisation [ ca ] Prerequisite: THA 2a or permission of the instructor... the Camera [ ca ] Prerequisite: THA 2a or permission of instructor. A process... Reproductive and Developmental Biology BISC 2a Human Reproduction, Population Explosion, Global...



Дата загрузки: 2017-12-26
Скачать документ
Скачать текст
0.05/5
... Auflösungen aus Runde 1: 1B; 2A; 3A; 4C; 5C; 6C; 7A... (1a), Abtrennung der zweiten Stufe (2a), Erreichen der Umlaufbahn, wo es...-Based (MEMS) PICOSAT Inspector (MEPSI)-2A/2B zwei kubusartige, durch ein... 350 x 335 ATLANTIS/ Cape Canaveral H-2A/ 484 x 491 Tanegashima 91,4 51... für die Fotoaufklärung. Ersetzt IGS O-1 und den Fehlstart IGS O-2. KomSat. für die Übertragung... 2006-036A 11 2006-037A IGS 3A Japan/ JAXA 12 2006... 2006-059A Kiku 8 (ETS 8) Japan H-2A/ Tanegashima GEO, 146º O 19 2006...,3 97,9 10 2007-001B CartoSat 2A Indien wie vor 641 x 621...



Дата загрузки: 2017-12-26
Скачать документ
Скачать текст
0.03/5
... region is known as the IGS and is highly variable in... the trnL-trnF intergenic spacer (IGS) have the potential to be... Strontium Strontium is in group 2A of the periodic table, which... b 2309097_2 c 2309099_3 a 2309099_3 b 2309099_3 c 2407081 2a 2407081 2b 2407081 2c 2407083 2a 2407083 2b 2407083 2c 2407085 ... 1c 21090911a 21090911b 21090911c 17061012-2a 17061012-2b 17061012-2c 170610... 1a, 1b, 1c Ashwicken 240708_2 2a, 2b, 2c Bawsey Country Park... intron and the trnL-trnF IGS of chloroplast genome among popular...



Дата загрузки: 2017-03-09
Скачать документ
Скачать текст
Скачать перевод
Посмотреть билингву
0.11/5
... wish to receive serious cases: – E.i.3.2a Results in Death – E.i.3.2b Life.../Number data element (G.k.2.1.1a, D.8.r.2a, D.10.8.r.3a) G.k.2.1.1a, D.8.r.2a, D.10.8.r.3a - MPID... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... be confirmed after ISO IDMP IGs are made available Business Rule... be confirmed after ISO IDMP IGs are made available Value Allowed... Text Business Rule(s) Mandatory if D.8.r.2a, D.10.8.r.2a, G.k.2.1.1a is populated Figure... (D.8.r.3a, D.10.8.r.3a, G.k.2.1.2a) D.8.r.3a, D.10.8.r.3a, G.k.2.1.2a - PhPID Version Date/Number... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... be confirmed after ISO IDMP IGs are made available Business Rule... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed...(s) Mandatory if D.8.r.3a, D.10.8.r.3a, G.k.2.1.2a is populated EU Individual Case... data element (D.8.r.EU.r.2a, D.10.8.r.EU.r.2a, G.k.2.3.r.2a) D.8.r.EU.r.2a, D.10.8.r.EU.r.2a, G.k.2.3.r.2a - Substance/Specified... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... be confirmed after ISO IDMP IGs are made available Business Rule... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... ISO IDMP IGs are made available Business Rule(s) Mandatory if G.k.2.3.r.2a is... be confirmed after ISO IDMP IGs are made available OID - Value... be confirmed after ISO IDMP IGs are made available Business Rule... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... be confirmed after ISO IDMP IGs are made available Business Rule... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... be confirmed after ISO IDMP IGs are made available Business Rule... requirements At least one of D.1, D.1.1.1,D.1.1.2, D.1.1.3,D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3,D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3. D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 ICH... (i.e. ‘CCYYMMDD’). At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5. See note 5 & 9 Mandatory... note 3 At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 ICH... CCYYMMDD (Minimum) Conditional-Mandatory ICH D.2.2a Age at Time of Onset... {Decade} Conditional-Mandatory Mandatory if D.2.2a is populated. See note 9 ICH... populated. At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 AN...-Mandatory At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5. See note 9 N - [0-6] - - - ICH... Text Optional Boolean - Optional AN D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 Minimum... Conditional-Mandatory EU D.8.r.1.EU.8 ICH D.8.r.2a ICH D.8.r.2b ICH D.8.r.3a ICH... / Specified Substance Name EU D.8.r.EU.r.2a Substance/Specified Substance TermID Version... is populated Mandatory if D.8.r.EU.r.2a is populated Mandatory if G.k.2.3.r.3b... Substance Name EU D.10.8.r.EU.r. 2a Substance/Specified Substance TermID Version... by the Reporter 1 N (1,2,3,4) Optional ICH E.i.3.2a Results in Death - Boolean - Mandatory... Must be the value 5 if E.i.3.2a = "True" Medical Confirmation by Healthcare... F.r.2.1 Test Name (free text) ICH F.r.2.2a ICH - - - Mandatory if F.r.2.2b or... G.k.1 ICH G.k.2.1.1a ICH G.k.2.1.1b ICH G.k.2.1.2a ICH G.k.2.1.2b ICH G.k.2.2 EU G.k.2.2.EU... G.k.2.1.2b is populated Mandatory if G.k.2.1.2a is populated - EU G.k.2.2.EU.9.r .1 Device... (repeat as necessary) ICH G.k.2.3.r.1 ICH G.k.2.3.r.2a ICH G.k.2.3.r.2b ICH G.k.2.3.r.3a Strength.../2013 - 250 - N Numeric Mandatory if G.k.2.3.r.2a is populated Mandatory if G.k.2.3.r.3b... AN Free Text Optional G.k.4.r.10.2a Route of Administration TermID Version... decimal point only. Mandatory if G.k.4.r.9.2a is populated. Mandatory if G.k.4.r.10... of Administration (free text) G.k.4.r.11.2a Parent Route of Administration TermID... Conditional-Mandatory Mandatory if G.k.4.r.11.2a is populated. - - - Mandatory if G.k.4.r.10... Primary Source 50 250 ICH G.k.7.r.2a ICH G.k.7.r.2b Indication (MedDRA code... only. See note 1 Mandatory if G.k.7.r.2a or G.k.7.r.1 is populated. See note...-Mandatory Mandatory if G.k.9.i.3.2a is populated N [1-4] Optional ICH G.k.9.i.3.2a ICH G.k.9.i.3.2b ICH... one of the following fields D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5. The use of...