Спутник ДЗЗ. IGS R-2a. [Редактировать]

Космический аппарат IGS 1B это радиолокационный аппарат дистанционного зондирования Земли разработанный корпорацией Mitsubishi Electric.

Дополнительная классификация

#Наименования
1Страна оператор(владелец) - Япония
2Страна производитель - Япония
3Тип орбиты - НОО
4Тип оператора(владельца) - государственный
5Радиолокационные спутники ДЗЗ
6Все спутники ДЗЗ

Технические характеристики

#ХарактеристикаЗначение
1Масса, кг1200
2Разрешающая способность (радара), метра3

Экономические характеристики

#ХарактеристикаДата измеренияЗначение
1Стоимость (аппарат), млн. долл.2003-11-29512

Информация о неудачном запуске

#ХарактеристикаЗначение
1Космодром Танегасима
2Дата пуска2003-11-29
3Полезная нагрузка 1xIGS O-2a
4Полезная нагрузка 1xIGS R-2a
5Ракета-носитель 1xH2A2024

Найдено 424 документов по запросу «IGS R-2a». [Перейти к поиску]


Дата загрузки: 2017-06-14
Скачать документ
Скачать текст
0.1/5
... consistent with recombination. The coalescent IGS genealogy confirmed subdivision and showed... of the nuclear ribosomal repeat (IGS) was an especially useful locus... the previous study, the 4-kb IGS was subdivided into 10 smaller... in each region (Fig. 1). IGS 1a and 2a are on one side... break between recombination blocks, and IGS 9a and 10a are on... four selected subregions of the IGS, the EF-1α, and pLK44.11... aligned sequences from different loci, (e.g., IGS 1a, 2a, 9a, and 10a) into... not (P < 0.05). When Fig. 1. The IGS locus, showing primers NLF2 and... regions were used, e.g., IGS 1a-11b and IGS 2a-10b for the 5′ region... Primer Sequence (5′ – 3′)b IGS IGS-1a IGS-11b IGS-2a IGS-10b IGS-3b IGS-10a IGS-2b CTCTCACCAAGGCATTGAGC TACACTCACCTCACCGGTAG... identified previously in the Americas, IGS 9a-10a sequence (approximately 800... the 4 kb of the entire IGS analyzed by Carbone and Kohn... the only portion of the IGS common to the present and... G. Malvárez G. Malvárez Population 3-2a Population 3-3a a Population 3-3 Population 3-4a... from multilocus data set. The IGS DNA sequence was analyzed first.... The compatibility matrix for IGS1a, 2a, 9a, and10a revealed conflict (Fig... blocks previously detected in the IGS (10). Much of the conflict..., IGS 1a-2a (which still presents internal conflict, [Fig. 3B]) and IGS 9a.... From a total of 754 bp, IGS 9a-10a presented 43 variable... in the case of the IGS locus, the Snn statistic showed... compatibility matrices for the locus IGS, generated using SNAP Clade (Markwordt.... A, Compatibility matrix for the combined IGS 1a, 2a, 9a, and 10 sequence... C, Compatibility matrices for the IGS 1a-2a and IGS 9a-10a sequences, respectively... the one obtained for the IGS 9a-10. Despite the lower... the intralocus conflict in the IGS. Given the genetic isolation of... combined data set, only the IGS 9a-10a was used. The... loci generated using SNAP Map (3). A, IGS 9a-10a; B, EF-1α; and C, 44..., and Washington for the loci IGS 9a-10a, EF-1α, and 44.11 IGS EF-1α 44.11 California Ontario... using MDIV (42) for the IGS 9a-10a. A, California versus Ontario... in the population-level analysis, IGS, EF1-α, and 44.11. The..., compared with species lineages. The IGS was an especially rich source... of Sclerotinia (10). Only the IGS provided enough characters to differentiate... the Ontario sample. Both the IGS and 44.11 differentiated a Washington... subdivision, Snn. Polymorphisms in the IGS provided higher resolution than the... a different genotype; recombination within the IGS locus; and interlocus recombination (IA... Genetree (4,19) for the loci IGS 9a-10a, 44.11, and... the mutations in the genealogy. A, IGS 9a-10a; B, 44.11; and...- Fig. 8. A, Haplotype map for the IGS 9a-10a locus for the... for North America for locus IGS 9a-10a ON AB NC...



Дата загрузки: 2017-09-25
Скачать документ
Скачать текст
0.09/5
... Social Science Quantitative Reasoning 1 ECON 2a Environmental Science 4,5 School of Science... HSSP HUM IIM IECS IEF IGS INET IMES ITAL JAPN JOUR...) Primarily for Undergraduate Students BISC 2a Human Reproduction, Population Explosion, Global... Capitalist Enterprise [ ss ] Prerequisite: ECON 2a (may be taken concurrently) or... of the Capitalist Enterprise ECON 2a Introduction to Economics Elective Courses...) Primarily for Undergraduate Students COSI 2a Introduction to Computers [ sn ] An...) Primarily for Undergraduate Students ECON 2a Introduction to Economics [ qr ss... China [ ss nw ] Prerequisite: ECON 2a. Analysis of China’s economic transformation... Environmental Economics [ ss ] Prerequisite: ECON 2a. Investigates the theoretical and policy... Asia’s Economies [ ss ] Prerequisite: ECON 2a. Examines the postwar economic performance... Analysis [ qr ss ] Prerequisite: ECON 2a. A first course in statistical inference... Management 166 Environmental Studies BISC 2a Human Reproduction, Population Explosion, Global... Health Economics [ ss ] Prerequisite: ECON 2a. Emphasizes the concepts and tools...: Science, Society, and Policy BISC 2a Human Reproduction, Population Explosion, Global... a Minor International and global studies (IGS) is an interdisciplinary program that... a deeper understanding of other cultures, IGS majors take one additional language... combination of the two). The IGS program thus combines a set of... faculty member teaching in the IGS program, but are encouraged to... specialization that they choose. Although IGS fulfills the university requirements as... studies curriculum. Students should take IGS 10a (Introduction to International and... (ECON 8b, Global Economy, or IGS 8a, Economic Principles and Globalization... for the Major A. Gateway course: IGS 10a (Introduction to International and Global Studies) A. Gateway course: IGS 10a (Introduction to International and...), ECON 8b (Global Economy) or IGS 8a (Economic Principles and Globalization...); ECON 8b (Global Economy) or IGS 8a (Economic Principles and Globalization... fulfill the requirements of the IGS minor must be taken for... the central issues of the IGS major. If extended international residence would be a hardship, IGS students may petition the IGS internship coordinator to... must receive permission of the IGS internship coordinator prior to starting... internship, and must enroll in IGS 89b (usually offered in the... (1–99) Primarily for Undergraduate Students IGS 8a Economic Principles and Globalization... ECON 2a and ECON 8b may not receive credit for IGS 8a... the courses counted toward the IGS major, and be engaged on a thesis project closely tied to IGS themes (as determined by the IGS honors coordinator). The student’s primary ... faculty member who teaches an IGS or IGS cross-listed course. The... one of whom teaches an IGS or IGS cross-listed course. Thesis students will register for IGS 99d (a fullyear course) with the... adviser. The first semester of IGS 99d may be used toward... requirement of two IGS electives (see requirement D, above). IGS departmental honors are... record in courses for the IGS major. H. No more than five... fulfill the requirements of the IGS major must be taken for...) and must be C or above. IGS 10a Introduction to International and.... Mr. Freeze or Mr. Ross IGS 89b Internship Seminar in International and Global Studies Prerequisite: IGS 10a. A weekly seminar combined with... course may count toward the IGS major requirement as an elective.... Usually offered every year. Staff IGS 92a Global Studies Internship This... offered only for non-IGS majors, or for IGS majors engaged in... been exempted from IGS 89b. Signature of the IGS internship coordinator is.... Usually offered every year. Staff IGS 98a Independent Study Usually offered every year. Staff IGS 98b Independent Study Usually offered every year. Staff IGS 99d Senior Research Seniors who... for degrees with honors in IGS must register for this course... ECON 8b The Global Economy IGS 8a Economic Principles and Globalization IGS 10a Introduction to International and ... BIOL 134b Tropical Ecology BISC 2a Human Reproduction, Population Explosion, Global... The Arts of Building Peace IGS 10a Introduction to International and...) Primarily for Undergraduate Students NEJS 2a Introduction to the Jewish Experience... The Sociology of Empowerment BISC 2a Human Reproduction, Population Explosion, Global... Undergraduate Singing [ ca ] Prerequisities: THA 2a or permission of instructor. May... Collaborative Process [ ca ] Prerequisites: THA 2a or permission of instructor. An... Design/Technical Practicum Prerequisites: THA 2a and 41a. Yields halfcourse credit... Stage Management Practicum Prerequisites: THA 2a and 41a. Yields halfcourse credit... Construction Fundamentals [ ca ] Prerequisite: THA 2a or permission of the instructor... Reproductive and Developmental Biology BISC 2a Human Reproduction, Population Explosion, Global... includes: Introduction to Economics (ECON 2a), Analysis of Economics Problems (ECON...



Дата загрузки: 2017-09-24
Скачать документ
Скачать текст
0.03/5
... Science Quantitative Reasoning Yes 1 ECON 2a Environmental Science 4,5 School of Science..., and Polilcy HUM IECS IEF IGS IIM INET IMES ITAL JAPN...) Primarily for Undergraduate Students BISC 2a Human Reproduction, Population Explosion, Global... Capitalist Enterprise [ ss ] Prerequisite: ECON 2a (may be taken concurrently) or... of the Capitalist Enterprise ECON 2a Introduction to Economics Elective Courses...) Primarily for Undergraduate Students COSI 2a Introduction to Computers [ sn ] An...-Computer Interaction [ sn ] Prerequisite: COSI 2a, or COSI 11a, or permission... Notes Relating to Undergraduates A . ECON 2a (Introduction to Economics) and ECON... Minor A. Successful completion of ECON 2a (Introduction to Economics) and ECON...) Primarily for Undergraduate Students ECON 2a Introduction to Economics [ qr ss... the Market [ ss ] Prerequisite: ECON 2a. Examines the strengths and limitations... Environmental Economics [ ss ] Prerequisite: ECON 2a. Investigates the theoretical and policy... of Education [ ss ] Prerequisite: ECON 2a. An introduction to economic analysis... Asia’s Economies [ ss ] Prerequisites: ECON 2a. Examines the post-war economic... ] Prerequisite: Successful completion of ECON 2a with a grade of C+ or higher... and Economics [ ss ] Prerequisite: ECON 2a. A study of economic foundations of... Labor Economics [ ss ] Prerequisite: ECON 2a. Topics include: Analysis of competitive... Analysis [ qr ss ] Prerequisite: ECON 2a. A first course in statistical inference...: The Role of Chemistry BISC 2a Human Reproduction, Population Explosion, Global... Policy BIOL 42a Physiology BISC 2a Human Reproduction, Population Explosion, Global... Minor International and global studies (IGS) is an interdisciplinary program that... a deeper understanding of other cultures, IGS majors take one additional language... combination of the two). The IGS program thus combines a set of... faculty member teaching in the IGS program, but are encouraged to... specialization that they choose. Although IGS fulfills the University requirements as... to International and Global Studies (IGS 10a) during their first or... (ECON 8b, Global Economy or IGS 8a, Economic Principles and Globalization... two sub-tracks) A. Gateway Course: IGS 10a (Introduction to International and...), ECON 8b (Global Economy) or IGS 8a (Economic Principles and Globalization... for the Minor A. Gateway Course: IGS 10a (Introduction to International and...), ECON 8b (Global Economy) or IGS 8a (Economic Principles and Globalization... the courses counted towards the IGS major, and be engaged on a thesis project closely tied to IGS themes (as determined by the IGS honors coordinator). The student’s primary ... faculty member who teaches an IGS or IGS cross-listed course. The... one of whom teaches an IGS or IGS cross-listed course. Thesis students will register for IGS 99d (a full-year course) with... advisor. The first semester of IGS 99d may be used towards... requirement of two IGS electives (See requirement D, above.) IGS departmental honors are... record in courses for the IGS major. H. No more than five... (1-99) Primarily for Undergraduate Students IGS 8a Economic Principles and Globalization... ECON 2a and ECON 8b may not receive credit for IGS 8a... offered every year. Mr. Coiner IGS 10a Introduction to International and.... Mr. Freeze and Mr. Ross IGS 92a Global Studies Internship Usually offered every year. Staff IGS 98a Independent Study Usually offered every year. Staff IGS 98b Independent Study Staff IGS 99d Senior Research... for degrees with honors in IGS must register for this course... ECON 8b The Global Economy IGS 8a Economic Principles and Globalization IGS 10a Introduction to International and ..., 1945 to the Present BISC 2a Human Reproduction, Population Explosion, Global... 132b, HIST 169a, HIST 179a, IGS 10a, NEJS 184a, PHIL 113b...) Primarily for Undergraduate Students NEJS 2a Introduction to the Jewish Experience... 144a Latin American Politics I BISC 2a Human Reproduction, Population Explosion, Global... honors. Required courses include: A. THA 2a Introduction to Theater Arts: From...-Physical Connection [ ca ] Prerequisite: THA 2a or permission of the instructor... Undergraduate Singing [ ca ] Prerequisities: THA 2a or permission of instructor. May... Collaborative Process [ ca ] Prerequisites: THA 2a or permission of instructor. An... Construction Fundamentals [ ca ] Prerequisite: THA 2a or permission of the instructor... 70a Directing [ ca ] Prerequisite: THA 2a or permission of instructor. Examines... Management: Part I [ ca ] Prerequisite: THA 2a or permission of the instructor... Musical Theater [ ca ] Prerequisite: THA 2a, or permission of the instructor... Costume Drafting [ ca ] Prerequisite: THA 2a or permission of the instructor... 109a Improvisation [ ca ] Prerequisite: THA 2a or permission of the instructor... the Camera [ ca ] Prerequisite: THA 2a or permission of instructor. A process... Reproductive and Developmental Biology BISC 2a Human Reproduction, Population Explosion, Global...



Дата загрузки: 2017-03-09
Скачать документ
Скачать текст
Скачать перевод
Посмотреть билингву
0.13/5
... wish to receive serious cases: – E.i.3.2a Results in Death – E.i.3.2b Life.../Number data element (G.k.2.1.1a, D.8.r.2a, D.10.8.r.3a) G.k.2.1.1a, D.8.r.2a, D.10.8.r.3a - MPID... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... be confirmed after ISO IDMP IGs are made available Business Rule... be confirmed after ISO IDMP IGs are made available Value Allowed... Text Business Rule(s) Mandatory if D.8.r.2a, D.10.8.r.2a, G.k.2.1.1a is populated Figure... (D.8.r.3a, D.10.8.r.3a, G.k.2.1.2a) D.8.r.3a, D.10.8.r.3a, G.k.2.1.2a - PhPID Version Date/Number... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... be confirmed after ISO IDMP IGs are made available Business Rule... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed...(s) Mandatory if D.8.r.3a, D.10.8.r.3a, G.k.2.1.2a is populated EU Individual Case... data element (D.8.r.EU.r.2a, D.10.8.r.EU.r.2a, G.k.2.3.r.2a) D.8.r.EU.r.2a, D.10.8.r.EU.r.2a, G.k.2.3.r.2a - Substance/Specified... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... be confirmed after ISO IDMP IGs are made available Business Rule... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... ISO IDMP IGs are made available Business Rule(s) Mandatory if G.k.2.3.r.2a is... be confirmed after ISO IDMP IGs are made available OID - Value... be confirmed after ISO IDMP IGs are made available Business Rule... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... be confirmed after ISO IDMP IGs are made available Business Rule... be confirmed after ISO IDMP IGs are made available OID To be confirmed after ISO IDMP IGs are made available Value Allowed... be confirmed after ISO IDMP IGs are made available Business Rule... requirements At least one of D.1, D.1.1.1,D.1.1.2, D.1.1.3,D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3,D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3. D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 ICH... (i.e. ‘CCYYMMDD’). At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5. See note 5 & 9 Mandatory... note 3 At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 ICH... CCYYMMDD (Minimum) Conditional-Mandatory ICH D.2.2a Age at Time of Onset... {Decade} Conditional-Mandatory Mandatory if D.2.2a is populated. See note 9 ICH... populated. At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 AN...-Mandatory At least one of D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5. See note 9 N - [0-6] - - - ICH... Text Optional Boolean - Optional AN D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5 See note 9 Minimum... Conditional-Mandatory EU D.8.r.1.EU.8 ICH D.8.r.2a ICH D.8.r.2b ICH D.8.r.3a ICH... / Specified Substance Name EU D.8.r.EU.r.2a Substance/Specified Substance TermID Version... is populated Mandatory if D.8.r.EU.r.2a is populated Mandatory if G.k.2.3.r.3b... Substance Name EU D.10.8.r.EU.r. 2a Substance/Specified Substance TermID Version... by the Reporter 1 N (1,2,3,4) Optional ICH E.i.3.2a Results in Death - Boolean - Mandatory... Must be the value 5 if E.i.3.2a = "True" Medical Confirmation by Healthcare... F.r.2.1 Test Name (free text) ICH F.r.2.2a ICH - - - Mandatory if F.r.2.2b or... G.k.1 ICH G.k.2.1.1a ICH G.k.2.1.1b ICH G.k.2.1.2a ICH G.k.2.1.2b ICH G.k.2.2 EU G.k.2.2.EU... G.k.2.1.2b is populated Mandatory if G.k.2.1.2a is populated - EU G.k.2.2.EU.9.r .1 Device... (repeat as necessary) ICH G.k.2.3.r.1 ICH G.k.2.3.r.2a ICH G.k.2.3.r.2b ICH G.k.2.3.r.3a Strength.../2013 - 250 - N Numeric Mandatory if G.k.2.3.r.2a is populated Mandatory if G.k.2.3.r.3b... AN Free Text Optional G.k.4.r.10.2a Route of Administration TermID Version... decimal point only. Mandatory if G.k.4.r.9.2a is populated. Mandatory if G.k.4.r.10... of Administration (free text) G.k.4.r.11.2a Parent Route of Administration TermID... Conditional-Mandatory Mandatory if G.k.4.r.11.2a is populated. - - - Mandatory if G.k.4.r.10... Primary Source 50 250 ICH G.k.7.r.2a ICH G.k.7.r.2b Indication (MedDRA code... only. See note 1 Mandatory if G.k.7.r.2a or G.k.7.r.1 is populated. See note...-Mandatory Mandatory if G.k.9.i.3.2a is populated N [1-4] Optional ICH G.k.9.i.3.2a ICH G.k.9.i.3.2b ICH... one of the following fields D.1, D.1.1.1, D.1.1.2, D.1.1.3, D.1.1.4, D.2.1, D.2.2A, D.2.2.1a, D.2.3 or D.5. The use of...



Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
0.11/5
... a range of a few kilometres. Precise IGS orbits were used. When comparing....202 m) are shown below. Table 2a shows the correct values of... 2c. The values in Tables 2a and 2b show very small... of the kinematic positioning. Tab. 2a Correct double differences DDNW and... using L1 ambiguities in Table 2a 72209.24 72209.22 9:30... File: IGR, ESAG; Final File: IGS, CODG) Temp. Final Avg of... are not the final data (IGS, CODG) but the temporary data... orbits IGS and ionospheric delay estimates CODG are used time Fig. 2a... addition, GPS data from several IGS sites in China during the... PRN29 and PRN21 observed at IGS sites WUHN and BJFS respectively... connected to International GPS Service (IGS) network. The network records, distributes... River (01/09) Melb obs (IGS station) (18/11) Clayton (12... and 3-8mm in height using IGS final orbits products (Brown, 2002... ITRF, GDA, MGA grid, and IGS precise ephemeris, etc. Further investigation... by the International GPS Services (IGS, 2000). The deformation analysis can... GPSnet, relatively stable and precise IGS/ARGN reference stations close to..., the "Melbourne Observatory" station in IGS There are a number of different... a fixed datum derived from three IGS stations (HOB2,STR1,TIDB)is... network. Irymple TIDB (IGS) STR1 (IGS) Cann River IGS station HOB2 (IGS) Fig. 6 An... solution. AUSPOS processing engine uses IGS precise ephemeris products, Earth orientation... and differential technique to several IGS stations. The data processing is... Australian tectonic motion vector from IGS The total displacement magnitude "V" is... Figure 12) derived from other IGS measurements (Geoscience Australia, 2004b). Since... (11): 1035-1039. IGS (2000): International GPS Services (IGS) - International Terrestrial Reference... not relative) troposphere measurements, three IGS stations were included in the... available from BKG’s website (http://igs.ifag.de/ntrip_down.htm). 3.3 Using...-Wesley, Boston. Ntrip Homepage, http://igs.ifag.de/index_trip.htm. Radio... of 129 International GPS Service (IGS) sites across Europe for over... up components, respectively. The corresponding IGS SP3 final orbits were also... (4) into equation (2), we have n g = 1 − a1 / f 2 − 2a 2 / f 3 − 3a3 / f 4 (5) Wang et al.: Triple... (4) and (5) into equation (6) gives 2 293 − 2a 2 / f 3 − 3a3 / f 4 )ds (8) s ∫ ∫ ∫ s s s = − (a1 / f 2 )ds − 2 (a 2 / f 3 )ds...



Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
0.03/5
..., p. 106, f ig. 5; Gordon, 1984, p. 22, f igs. 3D–F; Cook, 1985, p. 196, figs... gigantea: Busk, 1856a, p. 93, pl. 5, f igs. 1–2. Busk, 1886, p. 39; Hincks, 1880a, p. 535, pl. 77, f igs. 3–4; 1887b, p. 128. Marcus, 1937, p. 131.... 7, f ig. 1; Harmer, 1915, p. 68, pl. 5, f igs. 6–7; Marcus, 1937, p. 134, pl. 27..., 1971, p. 488; Menon, 1972b, p. 612, f igs. 24–29; Winston, 1982, p. 110...; Marcus, 1937, p. 139, pl. 28, f igs. 75A–B. Zoobotryon verticillatum: Soule in..., 1963, p. 18; Menon, 1972b, p. 618, f igs. 35–37; Winston, 1982, p. 113.... 13; 1984, p. 6, f ig. 11; 2004, p. 7, f igs. 3–4; Bock, 1982, p. 333, f ig. 9.5c... Hincks, 1887b, p. 127, pl. 12, f igs. 9–13; Kirkpatrick, 1890b, p. 603; Harmer..., p. 203, pl. 1, figs. 1–11, pl. 2, f igs. 12–19; Rogick & Croasdale, 1949..., 1963, p. 20; Menon, 1972b, p. 624, f igs. 50–51. Material examinado Presente... Aetea anguina (Linnaeus, 1758) Prancha 2A–B, 3A Tabela 3 Sertularia anguina Anguinaria..., fig. 1; 1884, p. 2; Hincks, 1880a, p. 4, pl. 1, f igs. 4–5; Osburn, 1912, p. 220, pl. 21..., p. 345; Canu & Bassler, 1920, p. 179, f igs. 47A–C, pl. 32, figs. 2–3; Harmer, 1926, p. 194, pl. 13, f igs. 3–4; Hastings, 1930, p. 702; 1932, p. 408; 1943, p. 472, f igs. 57A–C; Marcus, 1937, p. 26, pl..., p. 5, pl. 1, f ig. 1; Bock, 1982, p. 341, f igs. 9.6d–f; Hay ward & Ry land.... 10; Osburn, 1940, p. 347, pl. 1, f igs. 9–11; Soule, 1959, p. 4.; Cook, 1968a, p. 137; Gordon, 1984, p. 39, pl. 8, f igs. E–F; 1986, p. 44; Fransen, 1986, p. 12..., p. 278; Rogick & Croasdale, 1949, p. 43, f igs. 1–3; Hay ward, 1971, p. 481; Winston...; Hay ward & McKinney, 2002, p. 14, f igs. 5A–C. Material examinado Presente estudo..., 1852b, p. 31; Hincks, 1880a, p. 8, pl. 1, f igs. 8–11, pl. 2, f ig. 3; Osburn, 1914...; Hay ward & McKinney , 2002, p. 14, f igs. 5D–F. ? Aetea truncata: Marcus, 1938a..., 1940, p. 349; 1950, p. 23, pl. 2, f igs. 4–6; Rogick & Croasdale, 1949, p. 63; Maturo..., p. 124; Hastings, 1930, p. 706, pl. 3, f igs. 9–10. Nitscheina tuberculata: Jellyella tuberculata..., 1963, p. 170; Cook, 1968b, p. 134, f igs. 6a–b; 1985, p. 89, f ig. 26B..., f ig. 33; Fransen, 1986, p. 14, f igs. 4a–c. Material examinado Presente estudo..., 1937, [in part] p. 37, pl. 6, f igs. 14A, E–F. [non figs. 14B–D]; ?Cook...; Dick, Tilbrook & Mawatari, 2006, p. 2209, f igs. 5A–B. Material examinado Presente estudo.... 4; Canu & Bassler, 1919, p. 82, pl. 2, f igs. 5–7; 1920, p. 196, pl. 82, figs..., p. 410; Marcus, 1939, p. 131, pl. 8, f igs. 9A–C; Lagaaij, 1963, p. 482, text...: Lev insen, 1909, p. 190, pl. 1, f igs. 13a–e; Cheetham, 1966, p. 48, f ig.... g; Fransen, 1986, p. 41, f igs. 14a–h; Winston, 2005, p. 10, f igs. 15–19. Material...–F, 10C Johnston, 1840, p. 272, f igs. 1–2; 1847, p. 372, f igs. 69–70; Busk, 1852b, p. 32, pl. 24, f igs. 4–5; Hincks, 1880a, p. 96, pl. 4, f igs. 8–10; Robertson, 1905..., p. 504, f ig. 1; Hastings, 1943, p. 361, f igs. 18A–D; Osburn, 1947, p. 20. Material...; Sav igny, 1817, pl. 11, f igs. 3 1–5 . Marcus, 1938a, p. 24, pl. 5, figs..., p. 243; Sav igny, 1817, pl. 8, f igs.4 Prancha 12D 1–5 . Pieper, 1881, p. 43, 47, pl. 2, f igs. 5–7. Kirkpatrick, 1888, p. 504. Harmer, 1926, p. 398, pl. 27, f igs. 3–4; Osburn, 1927, p. 126; 1940, p. 402..., pls. 10E–F; Fransen, 1986, p. 57, f igs. 10a–g; Tilbrook, Hay ward & Gordon, 2001, p. 52, f igs. 6A,C; Hay ward & McKinney , 2002, p. 26, f igs. 10E–F; Tilbrook, 2006, p. 65, plat...–F; Gluhak, Lewis & Popijac, 2007, p. 399, f igs 3A–B. Material examinado Presente estudo.... 4, f ig. 5. Osburn, 1940, p. 377, pl. 5, f igs. 40–41; 1950, p. 109, pl...; Soule, Soule & Chaney, 1999, p. 32, f igs. 48–50. Material examinado Presente..., p. 243; Sav igny, 1817, p. 13, f igs. 3 Cothurnicella deadala Chlidonia deadala: Chlidonia.... 3–5. MacGillivray , 1885, p. 35, pl. 108, f igs. 2–2b. Busk, 1884, p. 8, pl. 28..., 1968a, p. 154; Gordon, 1989a, p. 450, f igs. 4–8; Wyse Jackson & Spencer Jones, 1996, p. 407, f igs 6G–H. Material examinado Presente estudo...; Sav igny, 1817, pl. 13, f igs. 2 Prancha 15E–F 1–5 . Alysidium lafontii: Busk, 1852b, p. 14, pl. 14, f igs. 1–5. Catenaria lafontii: Harmer, 1902, p. 305...; Hay ward & McKinney, 2002, p. 40, f igs. 17D–F. Material examinado Presente estudo...; Sav igny, 1817, pl. 13, f igs. 1 Prancha 15A–B 1–5 . Marcus 1937, p. 76..., figs. 40A–B; 1938a, p.31, pl. 7, f igs. 17A–B; 1939, p. 113, pl. 8, f ig.... 174A–E; Osburn, 1940, p. 464, pl. 9, f igs. 78–79; Correa, 1947, p. 1. Vittaticella... Harmer, 1957, p. 772, pl. 50, f igs. 4–5,15; Lagaaij, 1963, p. 202, pl...–F; Gluhak, Lewis & Popijac, 2007, p. 412, f igs 17A–C. 73 Material examinado Presente.... 11B; Osburn, 1940, p. 462, pl. 9, f igs. 75–77; Winston, 1982, p. 152...; Cheetham, Sanner & Jackson, 2007, p. 67, f igs. 1.2, 30.1, 30.2. Material examinado Presente...–B; 1955, p. 297; Winston, 2005, p. 89, f igs. 247–256. Material examinado Presente.... 2–3; Marcus, 1939, p. 153, pl. 11, f igs. 20A–C; 1955: 303; Osburn, 1940...



Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
0.04/5
...-2002 270 BGM-71E TOW-2A and/or BGM-71F TOW... incl or only practice TOW-2A missiles) 19 M-113 APC -2000... missile 2008 2008 2028 TOW-2A version 1 E-2C Hawkeye Second-hand... Corvette 2010 $319 m deal; TOW-2A version $165 m deal 1 DB-110... M-113A2 Mk1J BGM-71E TOW-2A and/or BGM71F TOW-2B..., 2015 86 BGM-71E TOW-2A version $12 m deal (incl 30... July 13, 2015 90 TOW-2A version Possibly $178 m deal; AIM... from UK BGM-71E TOW-2A version Part of $1.1 b deal; for... $416 m deal; BGM-71E TOW-2A version; for National Guard Second... production line BGM-71E TOW-2A version Probably Secondhand Second-hand... 2011 $177 m deal; BGM71E TOW-2A version; for National Guard Saudi... Guard BGM-71 TOW-2A and TOW-2A-RF versions; incl 9740... from the HY-1 missile  HY-2A: IR-guidance variant  HY-2AII: Improved variant of the HY-2A  HY-2B: Improved radar-guidance... inertial + infrared homing guidance (HY-2A); or inertial + monopulse active radar... or wards, such as Wards 2A, 209, 240, and 350 of... reportedly ran Evin Prison’s Ward 2A and Gohardasht Prison’s Ward 8. Human... the judiciary. The inspectors general (IGs), under the jurisdiction of the... internal but independent oversight. The IGs may render administrative decisions and... COI, and representatives of the IGs’ offices. When the agenda of... section 2.a.). Government officials and the IGs frequently contended that corruption investigations... to appear in court. The IGs claimed some ministers stifled their... lift by a majority vote. The IGs and other anticorruption officials lacked... security. High turnover among the IGs left positions unfilled for long periods. The IGs reported that these deficiencies were... Audit, COI, Central Bank, and IGs by leaving many officials in...-Tracked Wire-Guided Missiles (TOW-2A), 7 Fly-to-Buy RF TOW2A...-1RF Bunker Buster Missiles (TOW-2A), 7 Fly-to-Buy RF Bunker Buster Missiles (TOW-2A), 48 TOW-2 Launchers, AN/UAS... Navigation System (EGI), 6 AN/AVR-2A/B Laser Warning Detectors, 12 M261... Sale to Kuwait of TOW-2A/B Radio Frequency Missiles as well... a possible sale of 2,106 TOW-2A Radio Frequency missiles, 21 Buy... to Kuwait of 436 TOW-2A/B Anti-armor Guided Missiles as... sale of 288 TOW-2A missiles, 4 TOW-2A Flyto- Buy missiles, 140... tube-launched, optically-tracked wireguided 2A/2B radio-frequency (RF) Missiles... sale of 9,650 BGM-71 2A Tube-Launched, Optically-Tracked Wire... Aero RF missiles, 91 TOW-2A Fly-to-Buy missiles, 49... TOW2B missiles, 1,000 BGM-71 2A TOW missiles, 7 Fly-to-Buy...-Launched, Optically-Tracked, WireGuided (TOW-2A) Radio Frequency missiles and associated..., Optically-Tracked, Wire-Guided (TOW-2A) Radio Frequency missiles (42 missiles...



Дата загрузки: 2017-03-17
Скачать документ
Скачать текст
0.09/5
... WORKSHOP IN VENICE....................................................................... 25 4.1.4 HY-2A DATA DISTRIBUTION .......................................................................................................... 25 4.1.5 PLOTTOOL: A FAMILY... FOR ITRF2013 .............................................................................. 53 FIRST HY-2A ANALYSES ............................................................................................................ 55 COMMUNICATIONS..................................................................................................................... 56 FUTURE... series planned by China (HY-2A (2011), HY-2B (2012), HY... IGN/IPGP Analysis Center, France IGS International GNSS Service ILRS International... services - the International GNSS Service (IGS) for GPS, GLONASS and, in... data sets and products, the IGS was established and recognized as... to the other IAG Services (IGS: International GNSS Service, ILRS: International... web site in February. 4.1.4 HY-2A DATA DISTRIBUTION The Central Bureau... DORIS data of the HY-2A satellite. It coordinated the actions... POE processing; it includes HY-2A. (ftp://ftp.idsdoris.org/pub... Indies: reconnaissance in Guadeloupe, Martinique (IGS co-location)  Rio Grande: antenna... with a DGXX DORIS receiver.  HY-2A, a Chinese satellite (China Academy of... ENVISAT SPOT 5 JASON 2 CRYOSAT2 HY-2A SATELLITES 7 6 5 4 3 2 1 Figure 2 DORIS observations available... the other IAG geometric services (IGS, ILRS, IVS) and is shown... (SPOT-4, -5, Jason-1, -2, CryoSat-2, and HY-2A); data from future missions (e.g., SARAL... through 08-Apr-2012 HY-2A 01-Oct-2011 through present...) CryoSat-2 7 25 2.7 Envisat 6 26 1.9 HY-2A 7 29 3.1 Jason-1 11 27 3.5 Jason... from Jason-2, CryoSat-2, and HY-2A are also available in RINEX..., and 2.5 Mbytes for CryoSat-2, HY-2A, and Jason-2 respectively. In the... IAG services:      International GNSS Service (IGS) International Laser Ranging Service (ILRS... orbit determination results with HY-2A; (2) A report on the ground calibration... the utility of the HY-2A DORIS data. Guilhem Moreaux (CLS... of first series including HY-2A and iv) communications at EGU... to ITRF2008. 10.4 FIRST HY-2A ANALYSES At the end of... muti satellites solutions including HY-2A. HY-2A which was launched on... series shown that adding HY-2A has no major impact on... 30 (without HY-2A) and 32 (with HY-2A). 10.5 COMMUNICATIONS The... IERS 2003  Inclusion of HY-2A In 2012 we continued testing... for Jason-2, Cryosat-2 and HY-2A instead of the older DORIS... of the new satellite HY-2A in the combination. 12.2 SOUTH... estimates are provided by the IGS and were downloaded from the... collocated sites (from IDS and IGS networks) were chosen for comparison... are relevant to the METZ (IGS) [METB (IDS)] Kirkkonummi, Finland site..., to take into account HY-2A in the data analysis, to... solutions is lcawd30. When HY-2A data were made available, a second... as lcawd30 but with HY-2A in addition), has been generated... assess the contribution of HY-2A to the multi-satellite solutions... ENVISAT, Topex/Poseidon, Cryosat-2, HY-2A and the two Jason satellites... and daily EOP lcawd32 (+ HY-2a) 2011/10/02 - … STCD files... - … JASON-2: 2008 - CRYOSAT-2: 2010 - … HY-2A : 2011 - Table 11. List of... to take into account HY-2A. For this satellite, the data...) lets suggest also that HY-2A has reached a stable configuration (nominal... SRP coefficients estimated for HY-2A over 5 months IDS Annual Report 2012 74 HY-2A is now included in the... (1999), The International GPS Service (IGS), an interdisciplinary service in support... nouvelles mesures du satellite HY-2A et à l'amélioration ds mod...



Дата загрузки: 2017-10-09
Скачать документ
Скачать текст
0.07/5
...-­‐5108.     Altamimi,  Z.,  and  X.  Collilieux  (2009),  IGS  contribution  to  the  ITRF,  Journal...  P.  D.  Camargo  (2009),  Perfomance  of  the  IGS-­‐ Global  Ionospheric  Model  (GIM):  Evaluation...  global  navigation   satellite  systems  service  (IGS):  development  and  achievements,  Journal  of...),  Monitoring  storm-­‐enhanced  density  using  IGS   reference  station  data,  Journal  of...  and  draconitic  errors  in  the  IGS   orbits,  Gps  Solutions,  17(3),  413...  (2009),  Integrated  water  vapor   from  IGS  ground-­‐based  GPS  observations:  initial...,  S.  C.  Schaer,  and  A.  Krankowski  (2009),  The  IGS  VTEC  maps:  a  reliable   source  of...  non-­‐linear   variation  of  the  IGS  reference  station  coordinate  time  series...  single  receiver  DCB  estimation  using  IGS  TEC   maps,  Gps  Solutions,  16...  Seismological  Society  of   America,  103(2A),  971-­‐983.     Koehler,  R.  D.,  and  S.  G.  Wesnousky...  Seismological  Society  of   America,  99(2A),  566-­‐584.     Megawati,  K.,  T.  C.  Pan,  and...),  The  nighttime  anomalies  using  Global  IGS  VTEC   Maps,  Advances  in  Space...-­‐specific   multipath  characteristics  of  global  IGS  and  CORS  GPS  sites,  Journal....     Ray,  J.,  D.  Dong,  and  Z.  Altamimi  (2004),  IGS  reference  frames:  status  and  future...,  and  B.  Garayt  (2012),   IGS08:  the  IGS  realization  of  ITRF2008,  Gps  Solutions...  Seismological  Society  of  America,  103(2A),  936-­‐949.     Salomoni,  C.  S.,  M.  T.  Matsuoka,  S.  F.  De...  density  impact  on  DGPS   using  IGS  reference  station  data,  Journal  of...   software  precise  point  positioning  using  IGS  final  products  for  global  site...  precipitable  water  dataset  derived  from  IGS  tropospheric  products,   Journal  of  Geodesy...,  X.  L.  Luan,  and  G.  L.  Yang  (2006),  Using  IGS  data   to  analysis  the  global...



Дата загрузки: 2017-03-09
Скачать документ
Скачать текст
0.06/5
... altas de enero a marzo (fig. 2A). En cambio, en el río Desaguadero... materia disuelta, de enero a diciembre. 2A: caudales medios mensuales (O, en m- 3 s-1). 28... (eje y filoides) corticado total o parcialmente 2a • Estípulas en un solo... vistas del opérculo. Fig. 2a : Rhamphopoma parvum ; 2 b : diferentes vistas del...; 1e : adulto. Fig. 2 : Pisidium meierbrooki; 2a : perfiles laterales en diversos estados.... Fig. 2 - Eylais crawfordi Viets : fig. 2a, ojos del macho; fig. 2b....), 1961. - Notas sobre Corixidae (Hemiptera) (2a seria). Neotropica, 7 : 19-24. BACHMANN... Orestias forgeti Orestias ispi 1+2 3+4 5.1 65 IGS 4.1 % F5 + F6 64 5+6 7+8 9 + 10 4.2 7.1 7.2 64... + 12 3.5 44 IGS 6.5 6.7 8.9 8.7 % F5 + F6 100 80 80 64 IGS 6.8 3.9 8.8 4.4 92 30... 86 7.7 % F5 + F6 65 73 IGS 8.6 11.0 % F5 + F6 100 100 43 10.4 IGS 7.6 6.9 5.2 9.0 8.5 6.7 % F5 + F6 71 71 50 79 83 67 Orestias IGS 6.0 7.1 6.9 5.6 % F5 + F6 7.6 77 6.4 o/ivaceus 77... 93 72 Orestias futeus Orestias IGS pentlandli' % F5 + F6 4.6 77 2.9 4.4 8.1 3.6 4.4 67... reproducción para 7 especies de Orestias. IGS : índice gonosomático medio. % F5...ón del índice gonosomático medio (IGS) de las hembras. El porcentaje... año así como el valor del IGS. Esto muestra que la reproducci..., el IR es igual a : IGS hembra + 5.5 IGS macho. Para su interpretación, hay... los diferentes estados de maduración e IGS medio en función de las... MESES Fig. 1. - Variaciones bimestrales del IGS y del índice de reproducción IR... disminuye con la elevación del IGS -, y los peces gordos, del tipo..., y n,o está decalada con relación al IGS (BOUGIS, 1952 ; BERTIN, 1958 a y b ; HUREAU... cuales 3 son bien conocidos, el IGS, la RHS y el coeficiente de... Prepúberos 140-199 mm IGS <0.3 % X v N Adultos jóvenes 140-199 mm IGS > 0.3 % X v N 1.33 0.7840 14 2.03 0.2646 ... Prepúberos 200-249 mm IGS<0.3% X v N 0.16 0.0064 39 3.14 0.6353... Adultos jóvenes 200-249 mm IGS> 0.3 % X v, N 1.38 0.6175 75 2.48 1.0830... 74 Adultos 250-299 mm IGS < 0.3 % X v N 0.11 0.0054 26 3.13 0.8272... 33 Adultos 250-299 mm IGS > 0.3 % X v N 1.28 0.3229 47 2.54 0.6020... 0.0114 47 Adultos 300 mm IGS < 0.3 % X v N 0.11 0.0046 21 3.13 1.3400... 0.0159 27 Adultos 300 mm IGS > 0.3 % X v N 1.24 0.4332 42 2.60 0.9950... relativos a las materias de reserva. S = IGS + RHS + RPS ; X, promedio; v, varianza; N, números... menos 5 %, teniendo en cuenta el IGS de los machos en maduraci... los inmaduros y prepúberos, cuyo IGS permanece bajo, la RHS y la... relativos a las materias de reserva. S = IGS + RHS + RPS ; X, promedio; v, varianza; N, número... un pez dado el del IGS. Con respecto al choque fisiol... simple, de gran tamaño (fig. 2a - vista lateral; fig. 2b - vista...