Спутник ДЗЗ. TET 1. [Редактировать]

TET-1 (Technologieerprobungsträger 1) это ключевой элемент программы On-Orbit Verification Program(OOV), которая проводится немецким DLR. Главной задачей этого проекта является отработка новых технологий в условиях космоса в течении не менее одного года. Всего на борту аппарата планируется провести порядка 11-и экспериментов. Первоначально планировалось запустить этот аппарат в 2010 году, однако, в последствии, его пуск был перенесен на 2012 год. Спутник должен быть запущен на солнечно-синхронную орбиту с высотой около 500 км. Головным разработчиком аппарата являлась Kayser-Threde GmbH (получила контракт в июле 2008 года). Аппарат обладает платформой которая была создана Astro- und Feinwerktechnik Adlershof GmbH (Astrofein) по контракту с головным исполнителем. В качестве основной полезной нагрузки на аппарате установлена сборка из трех pushbroom камер, одна из которых работает в ближнем ИК, а вторые две в инфракрасном диапазонах. Предполагается, что данный аппарат послужит прототипом для систем  наблюдения за пожарами из космоса.

Дополнительные наименования

#НаименованияПоиск в новостяхПоиск в документах
1FireBird 1НайтиНайти

Дополнительная классификация

#Наименования
1Страна оператор(владелец) - Германия
2Страна производитель - Германия
3Тип оператора(владельца) - государственный
4Тип орбиты - НОО
5Все спутники ДЗЗ

Технические характеристики

#ХарактеристикаЗначение
1Масса, кг120

Экономические характеристики

#ХарактеристикаДата измеренияЗначение
1Стоимость (аппарат), млн. евро21

Информация об удачном запуске

#ХарактеристикаЗначение
1Космодром Байконур
2Дата пуска2012-07-27
3Полезная нагрузка 1xКанопус-В
4Полезная нагрузка 1xМКА-ФКИ 1
5Полезная нагрузка 1xБКА
6Полезная нагрузка 1xExactView-1
7Полезная нагрузка 1xTET 1
8Ракета-носитель 1xСоюз-ФГ с РБ «Фрегат»

Найдено 1000 документов по запросу «TET 1». [Перейти к поиску]


Дата загрузки: 2017-03-28
Скачать документ
Скачать текст
Скачать перевод
Посмотреть билингву
0.24/5
... that Non-player VC executing “Tet” will place Guerrillas if they... Event, however. Like all Events, “Tet Offensive” is to be implemented... is no choice here—for “Tet”, the VC, whether player or... Support…. The next bit of “Tet” Event text says: “Place 6 VC... VC’s Pivotal Event – card #124 “Tet Offensive” – already playable (barring a Monsoon..., 2.3.9). The VC therefore immediately play “Tet Offensive”, cancelling “Laser Guided Bombs... question in any case, because “Tet Offensive” would delay (“trump”) any...-players played their Pivotal Events.) “Tet Offensive” shows a halo around the... Random Spaces foldout and find “Tet Offensive”. (It is listed together...’s have the VC launch the Tet Offensive! Where? The instruction says... and final VC Guerrilla there. “Tet Offensive” next dictates that “VC... Vietnam just after the VC’s Tet Offensive. © 2014 GMT Games, LLC... above priorities being equal. Per “Tet”, the VC must take the.... … The VC player keeps the “Tet Offensive” holstered for now, so... elects not to execute the “Tet Offensive” at this time, leaving... gun line during the 1968 Tet Offensive (Pivotal Event 124). 31... a diversion in support of the Tet Offensive assaults on South Vietnam.... 41. Bombing Pause NAUV 1968 Tet holiday gesture: Set any 2 spaces... end comes into view.” The Tet Offensive the following January (Pivotal... error, as some view the Tet Offensive to have been a US... out of play. Aid –9. limited, Tet Offensive, this time focused on... per space. False progress: If Tet Offensive played, return it to... shaded text, if Event #124 “Tet Offensive” has not been executed... in this scenario), execute the “Tet Offensive” Event text that follows... uprising”. The disposition of the “Tet Offensive” card is not affected... Pacification Campaign” was a US post-Tet campaign based on a clear and... sufficient strength from the 1968 Tet defeat (Pivotal Event 124) to... the infrastructure that supported the Tet offensive attacks in Saigon in... to vindicate the approach. 124. Tet Offensive VNUA VC Pivotal Event... Viet Cong losses in the Tet Offensive and the Phoenix Program... that from 1954 until the Tet Offensive (1968) the VC 47... that Hanoi’s hidden agenda during Tet was to decimate the ranks... pivotal event mechanic was the Tet Offensive and how the character... War that carried forward, until Tet’s military failure neutered the VC... last phase (1968) begins with Tet [124] and finishes with Linebacker... NVAU 123. Vietnamization AUNV 124. Tet Offensive VNUA 125. Coup! Nguyen...



Дата загрузки: 2017-03-29
Скачать документ
Скачать текст
0.06/5
... in Vietnam . . . . . . . . Critical Thinking: The Tet Offensive Checking Vocabulary . . . . . . . . . Test . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . SECTION... U.S. military strategy, and finally, the Tet Offensive in February 1968. On..., it loses the war. The Tet Offensive is the beginning of..., the North Vietnamese launch the Tet Offensive, an attack against more... threat. Ī To understand how the Tet Offensive led eventually to U.S. withdrawal... suffered such heavy losses during Tet that it could not have... a television news broadcast about the Tet Offensive. Students will need to... U.S. troops from Vietnam after the Tet Offensive. What reasons existed for... strategy in Vietnam, or the Tet Offensive). Then have each group... 9. Tonkin Resolution __________________________________________________________________ ______________________________________________________________________________ 10. Tet Offensive ____________________________________________________________________ ______________________________________________________________________________ 17 © Copyright... Robert McNamara Saigon Tao Chung Tet Offensive The United States The... War Name CRITICAL THINKING: THE TET OFFENSIVE Think about how the... and U.S. citizens felt that the Tet Offensive had been successfully halted... not have continued fighting after Tet, do you think the outcome... Hanoi Maddox Saigon Tao Chung Tet Offensive Tonkin Resolution torpedo Viet... Christmas bombing of Hanoi the Tet Offensive None of the above... TEST (CONTINUED) 5. Even though the Tet Offensive was a huge failure for... seemingly endless brutality of war. Tet was larger than U.S. intelligence officials... Christmas bombing of Hanoi the Tet Offensive None of the above... 9. Tonkin Resolution __________________________________________________________________ ______________________________________________________________________________ 10. Tet Offensive ____________________________________________________________________ ______________________________________________________________________________ 31 © Copyright... send more troops to Vietnam. 6. Tet Offensive The ______________________________ was a series... Robert McNamara Saigon Tao Chung Tet Offensive The United States The... VARY, BUT SHOULD INCLUDE THE TET OFFENSIVE AND PRESIDENT JOHNSON DECIDING... page 23 CRITICAL THINKING: THE TET OFFENSIVE Think about how the... and U.S. citizens felt that the Tet Offensive had been successfully halted... not have continued fighting after Tet, do you think the outcome... Hanoi Maddox Saigon Tao Chung Tet Offensive Tonkin Resolution torpedo Viet... Christmas bombing of Hanoi the Tet Offensive None of the above... TEST (CONTINUED) 5. Even though the Tet Offensive was a huge failure for... seemingly endless brutality of war. Tet was larger than U.S. intelligence officials... Christmas bombing of Hanoi the Tet Offensive None of the above...



Дата загрузки: 2017-04-09
Скачать документ
Скачать текст
0.1/5
... Tet-12 Qer-12 Shk-12 Tet-11 Qer-11 Shk-10 Tet-10 Qer-10 Shk-10 Tet-09 Qer-09 Shk-09 Tet... -0.15 Jan- 14 Dhj- 12 Tet -12 Gus- 12 Qer-12...-12 Shk-12 Dhj-11 Tet-11 Gus-11 Qer-11...-11 Shk-11 Dhj -10 Tet-10 Gus-10 Qer-10...-10 Shk-10 Dhj -09 Tet-09 Gus-09 Qer-09...-09 Shk-09 Dhj -08 Tet -08 Gus-08 Qer-08...-07 Jan- 14 Dhj- 12 Tet -12 Gus-12 Qer-12...-12 Shk-12 Dhj-11 Tet-11 Gus-11 Qer-11...-11 Shk-11 Dhj -10 Tet-10 Gus-10 Qer-10...-10 Shk-10 Dhj -09 Tet-09 Gus-09 Qer-09...-09 Shk-09 Dhj -08 Tet -08 Gus-08 Qer-08... 0 -0.1 -0.05 -0.2 Jan- 14 Dhj- 12 Tet -12 Gus-12 Qer-12...-12 Shk-12 Dhj-11 Tet-11 Gus-11 Qer-11...-11 Shk-11 Dhj -10 Tet-10 Gus-10 Qer-10...-10 Shk-10 Dhj -09 Tet-09 Gus-09 Qer-09...-09 Shk-09 Dhj -08 Tet -08 Gus-08 Qer-08...-07 Jan- 14 Dhj- 12 Tet -12 Gus-12 Qer-12...-12 Shk-12 Dhj-11 Tet-11 Gus-11 Qer-11...-11 Shk-11 Dhj -10 Tet-10 Gus-10 Qer-10...-10 Shk-10 Dhj -09 Tet-09 Gus-09 Qer-09...-09 Shk-09 Dhj -08 Tet -08 Gus-08 Qer-08..., Banka Qendrore e Serbisë ka rritur tetë herë normën bazë që nga qershori... prej 18 711 000 SEK (tetëmbëdhjetë milionë e shtatëqind...ëdhjetë e shtatë milionë e dyqind e tetëdhjetë e tetë mijë e nëntëqind e gjashtëdhjet...ë 37 806 (tridhjetë e shtatë mijë e tetëqind e gjashtë) lekë/m2, për sip...



Дата загрузки: 2017-04-09
Скачать документ
Скачать текст
0.36/5
... kie­ro­wał Ko­mi­tet Cen­t­ral­ny KP(b)B, kt...­wo­do­wy Ko­mi­tet KP(b)B przy­jął pos­ta­no...­for­mo­wał Ko­mi­tet Cen­t­ral­ny KP(b)B, że nie... ra­por­ty Ko­mi­tet Cen­t­ral­ny żą­dał wy...­pew­nia­li Ko­mi­tet Cen­t­ral­ny: „My chce...­wo­do­wy Ko­mi­tet KP(b)B wy­dał pos­ta... czer­w­ca 1943 r. Ko­mi­tet Cen­t­ral­ny KP(b)B wy...­ny zos­tał Ko­mi­tet 58. Naz­wa po­ cho... rep­res­ji4. Ko­mi­tet 58 z ar­tys­ta­mi...­leż­noś­ci. Ko­mi­tet skła­dał się z biu­ra...­tęp­ne­go dnia Ko­mi­tet Or­ ga­ni­za­cyj... przez mi­lic­ję8. Ko­mi­tet Or­ga­ni­za­cyj...­ło­ru­skie­go”9. Ko­mi­tet Or­ga­ni­za­cyj... stycz­nia 1989 r., Ko­mi­tet Or­ga­ni­za­cyj...­te­go 1989 r. Ko­mi­tet Or­ga­ni­za­cyj...­no­by­lu. Ko­mi­tet nie zos­tał do­pusz...­li KPZR”16. Ko­mi­tet Or­ga­ni­za­cyj... uz­na­no pa­ry­tet po­mię­dzy „pra­wa... (BSDH)37. Jej ko­mi­tet or­ga­ni­za­cyj...­to­ ria, Uni­wer­sy­tet w Bia­łym­s­to­ku, Bia...­to­ria, Uni­wer­sy­tet w Bia­łym­s­to­ku, Bia... i pro­pol­ski Ko­mi­tet Bia­ło­ru­ski. Sto­ją­cy...ść je­go au­to­ry­tet. Po­nad­to wpro­wa...



Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
0.11/5
... illusztrÀci Keresztury Tibor àF¢lterpeszbenÊ cÁmü k´tet¢hez) ã 883 Hajdà Gergely: Fiatals...¢d csak, kakas, mibe a sz¢l kap, ¢s a tetûn nem szÂl kiÀltozÀstok... annak, ami û; azt az egyben-l¢tet, amit ez a sugallt ´sszemosÀs sejtet...ûÁteni. Amikor Bulcsà KÀroly versesk´tet¢t bÁrÀlva, 1860-ban visszatekint az.... 274ä275. o. 3. BVT I. k´tet, 274ä276. o. 4. BVT II. k´tet, 371., 373. o. 5. V´. Martin.... 342ä350. o. 14. BVT III. k´tet, 23. o. 15. V´. Ludassy MÀria: KRISZTUS.... 156ä214. o. 16. V´. BVT III. k´tet, 19ä22. o. 17. V´. uo. 22... MÀria: i. m. 183. o. 19. BVT III. k´tet, 24. o. 20. Uo. 32. o. 21. BVT I. k´tet, 276ä277. o. 22. V´. Ludassy MÀria..., 1992. 113. o. 25. BVT III. k´tet, 30. o. 26. Uo. 77ä78... leszÀmÁtva csak az elsû k´tet k¢sz¡lt el (àGENTILIZMUSÊ. A BARB...Àt szerezte meg, ¢s ¢let¢ben ez a k´tet is k¢ziratban maradt. (1992-ben...´tetes MAGYARORSZçG T¹RT°NETE mÀsodik k´tet¢nek egyik kiszemelt szerzûje... mÀsf¢l ¢vtizedet vett ig¢nybe, ¢s a k´tet, amelyet az olvas a kez¢ben...Ê val beilleszt¢s v¢gett. MindazonÀltal a k´tet v¢g¡l is befejezetlen¡l maradt, s ez¢rt... szerep. ýt a t´rt¢netÁrÂi gondok nyomasztottÀk. Tetû alÀ akarta hozni hosszà ¢vek... forrÀsaibÂl merÁtettek.28 A k´tet szerzûi valamennyien sajÀt, egymÀst... T¹RT°NETE nem polemikus mü, jÂllehet a k´tet szerzûi szÀmos tÀrgyrÂl mÀsk... vele: a debreceni egyetem konferenciÀt szervezett a k´tet szerzûi ¢s mÀs t´rt¢n¢szek r¢szv¢tel... PÀl megjegyz¢seit RÀcz TANULMçNYOK cÁmü k´tet¢ben, 18ä19. o.; lÀsd m¢g: VITA...Ànyom sz´veg¢be iktattam, k´tet ¢s lapszÀm szerint. A k´tetek r´vidÁt¢sei...ºRK°N°L I. USZ II.= ugyanaz, II. k´tet. 2. Ezt a hasonlatot EsterhÀzy P¢ter...Álott a k¢nk´ves kÃt ä, megjÀtssza a t¢tet: àazt hiszem, mondom vaktÀban... ILLUSZTRçCIñ KERESZTURY TIBOR àF°LTERPESZBENÊ CíMþ K¹TET°HEZ BETELT, MAMA, A HAMUTARTñ a cselekm... egyszer lÀbra kap) Marno JÀnos k´tet¢rûl a cselekm¢ny isten, ha egyszer...ûve a k´nyvbe), egy ilyen nagyszerü k´tet fejlûdhess¢k ki. Mert a TEREMTM...¢szet¢t a fest¢szettel rokonÁtja, mÁg k´tet¡nknek p¢ldÀul ez a sora...: GY¹NY¹R¹K KERTJE)? Mert ha a k´tet àlovagolj csak e pontyonÊ sorÀt veszem... megemlÁtendûnek k´tet¢rûl, az a SZ°NçSSZEK°R cÁmüt. K´tet¢vel kapcsolatban ugyanis az... az ¢letben maradni akarÀsÀtÂl magÀt a l¢tet. Ez persze papolÀs volna t´bbes...ÂjÀnak a szabadsÀgot tekinti, egy k´tet, cÁme a k¢p¢, ÀllÁtÀsa (r¢szÀll... SzilÀgyi çkos korÀbbi k´tet¢rûl, a FEJ °S TUDAT-rÂl (melyben a GY¹NY..., ha itt van ez a ragyog k´tet (¢s van, kiadta a Holnap KiadÂ, '91...¢g¢re legyen mondva, hogy elsû k´tet, ki¢rlelt Kukorelly¢rt forduljunk... tekintve lehetett volna belûle (a k´tet '84-es, a MAGYAR NEMZETI T°GLA... be az irodalmi t¢rbe. Hogy a k´tet mÂdszere miben volt Ãj, annak felt...¢szÁtû rem¢l, az az, hogy a k´tet ezekkel az evûeszk´z´kkel... mÀr borecet? Solymosi BÀlint MþN°GER-e reprezentatÁv k´tet. Nem is lehetne mÀs, hisz a JAK...¢g¢t felid¢zû MesterhÀzi MÂnika Ág¢retes k´tet¢ben lÀthattuk ennek hasonl megtagad... majdnem utols kÁvÀnsÀgÀra, Sziveri k´tet¢t dÁszÁtette! Legy¡nk prec.... Az û dicsûs¢g¢t szolgÀlja e kis k´tet, amelyben valÂjÀban k¢t barÀt lev.... Ezt a levelet viszont nem k´zli k´tet¡nk, pedig a k¢t essz¢lev¢l valamif...Àval. Nem der¡l ki francia k´tet¡nkbûl az sem, hogy ki... k´lcs´n´z alakjainak. Ezt az ellent¢tet talÀn egy harmadik redukci magyar... fednie a testet, s reprezentÀlnia a jelenl¢tet. A test-l¢lek (szellem, tudat) dualizmus... a kagylÂs formÀt. °ppen ez a hÁres, k´tet¡nk cÁmlapjÀn is szereplû s ä f¢lû ä a sok...-technikÀval k¢sz¡lt mü, az ºLý PçR (k´tet¡nkben ¹LEL°S cÁmen ä 99. o.) k¢ts... a f¡lsz´veg ÀllÁt, hogy àez a k´tet a festû oeuvre-j¢nek valamennyi jelent...



Дата загрузки: 2017-06-16
Скачать документ
Скачать текст
0.06/5
... dinBΔ .......................................................................................277 4.3.1 dinB-TET (primer pair A) ..........................................................................277 4.3.2 TET-dinB (primer pair B) ..........................................................................278... chromatogram example of PCR product B (TET- dinB) from CP1015..........................................................................................................279 Figure... PEN CTX ERY CLIN CHL TET SXT 23F Spain -1 23F 81... – erythromycin; CLIN – clindamycin; CHL – chloramphenicol; TET – tetracycline; SXT – trimethoprim- sulphamethoxazole. 43... 1994 STP002 19F Christchurch, NZ E, S/T, TET 1a 1997 STP003 19F Christchurch, NZ E, S/T, TET 1a 1997 STP013 19F Christchurch, NZ E, S/T, TET 1a 1997 STP022 19F Christchurch, NZ E, S/T, TET 1a 1997 STP026 19F Christchurch, NZ E, S/T, TET 1a 1997 STP028 19F Christchurch, NZ E, S/T, TET 1c 1997 STP031 19F Christchurch, NZ E, S/T, TET 1a 1997 STP038 19F Christchurch, NZ E, S/T, TET 1a 1998 STP057 19F Christchurch, NZ E, S/T, TET 1a 1998 STP110 19F Christchurch, NZ E, S/T, TET 1a 1998 STP133 19F Christchurch, NZ E, S/T, TET 1a 1998 STP138 19F Christchurch, NZ E, S/T, TET 1a 1998 STP194 19F Christchurch, NZ E, S/T, TET 1a 1998 STP221 19F Christchurch, NZ E, S/T, TET 1d 1998 STP269 19F Christchurch, NZ E, S/T, TET 1b 1998 Ref clone (Coffey... al., 1998) Taiwan19F-14 19F E, S/T, TET 9V 14 Table 2.2.1: Origin of...; CX – Cefotaxime; S/T – Sulfamethoxazole-trimethoprin; E – Erythromycin; TET – Tetracycline; Ref clone – PMEN reference... CGGCAACTACCTGTTTTGGT 20 57.3 50 dinB-TET TET-dinB Rifampicin Product Size (bp... – 4124bp. PCR product A (dinB-TET) and B (TET-dinB) confirm location of the... of the tetM insert (dinB-TET). Primer pair B (figure 4.3 – B FP, B RP... of the dinB sequence (TET-dinB). 4.3.1 dinB-TET (primer pair A) 4.3.1a: PCR using primer pair A (dinB-TET: figure 4.3) to amplify region in... out mutants. 277 Chapter 4 DinB-TET PCR products were confirmed to... example of PCR product A (dinB-TET: figure 4.3) from CP1015 (1) dinB knock... the XhoI restriciton site (black). 4.3.2 TET-dinB (primer pair B) Figure 4.3.2a: PCR using primer pair B (TET-dinB: figure 4.3) to amplify region... Chapter 4 Amplification and sequencing of TET-dinB further confirmed dinBΔ (4.3.2a... chromatogram example of PCR product B (TET- dinB) from CP1015 dinB knock.... Tn5253, the pneumococcal omega (cat tet) BM6001 element, is a composite structure..., G. 1996. The tetracycline resistance gene tet(M) exhibits mosaic structure. Plasmid, 35...



Дата загрузки: 2017-03-26
Скачать документ
Скачать текст
0.09/5
... Gus 09 Total Mar 09 Tet 08 Maj 08 Total 2012M2... ‘12 Qer ‘11 Sektori privat Tet ‘10 Shk ‘10 Qer ‘09 Sektori publik Tet ‘08 Shk ‘08 Qer ‘07 Shk '06 Individët Tet ‘06 Shk ‘12 Qer ‘11 Sektori publik Tet ‘10 Shk ‘10 Qer ‘09 Sektori privat Tet ‘08 Shk ‘08 Qer ‘07 0 Tet ‘06 100 - Shk ‘06 20 ... ‘12 Sektori privat Qer ‘11 Tet ‘10 Shk ‘10 Qer ‘09 Sektori publik Tet ‘08 Shk ‘08 Qer ‘07 Shk '06 Individët Tet ‘06 Shk ‘12 Sektori privat... Sektori publik Shk ‘10 - Tet ‘10 0 Tet ‘08 50 Shk ‘08 50 Shk ‘06 100 Tet ‘06 100 Individët Burimi: Banka... të paguar në shumën 80 000 000 (tetëdhjetë milion) euro, asetet neto... (pesëqind e tridhjetë e dy mijë e tetëqind e njëzet e tre dhe... (njëzet milion e katërqind e tetëdhjetë e dy mijë euro). Qëllimi....38 (pesë milionë, e katërqind e tetëdhjetë e katër mijë e gjashtëqind e gjashtëdhjetë e tetë e 38/100) USD. Kjo shum...ë jo më pak se 18 295 (tetëmbëdhjetë mijë e dyqind e nënt...



Дата загрузки: 2017-03-28
Скачать документ
Скачать текст
Скачать перевод
Посмотреть билингву
0.27/5
... 30 January 1968, as the Tet holiday started, the communists launched... enemy suffered heavy losses, but Tet’s impact upon US public opinion... clouded by charges that the Tet offensive’s scope and timing had... changed course over Vietnam. After Tet, and with Secretary McNamara gone... was reprogrammed, but emergencies—the Tet offensive and seizure of the..., with North Korea unyielding and Tet battles raging, General Wheeler gave... feeling received a large boost. If Tet was ending in a communist defeat..., giving a public already shaken by Tet yet another jolt. The strength... a “significant improvement” over the post-Tet low point. Two STRAF divisions... modest mobilization in response to TET and the Pueblo crisis was... USS Pueblo’s seizure and the Tet offensive, the strategic reserve virtually....61 In South Vietnam, the Tet offensive had begun and the... initiate hostilities.” However, when the Tet offensive erupted only a week later... In any case, even before Tet, the administration opted for a diplomatic... In February 1968, confronting the Tet offensive and the USS Pueblo... the American public took the Tet offensive to be final proof... was in Vietnam making a post-Tet assessment. 313 Notes to Pages...–42 strategy for: 253–54 Tet offensive: 59 transportation needs: 45...



Дата загрузки: 2017-06-16
Скачать документ
Скачать текст
0.1/5
...- oder einer 3-Tasten-Fernbedienung ausgestat‐ tet sein. Die Fernbedienung hat eine... entspre‐ chenden Türen bleiben eingeschal‐ tet. Zum Entriegeln die Seite 0 des...‐ geln und entriegeln (sofern ausgerüs‐ tet). Zum Öffnen der rechten hinteren.... Die LED im Schalter leuch‐ tet auf. Die andere Seite des... Sitz absenken, bis er einras‐ tet. 3. Sicherstellen, dass der Sitz sicher...‐ men. Wenn Z zusammen mit A aufleuch‐ tet, das Fahrzeug stoppen und den... zusammen mit der Kontrollleuchte C) aufleuch‐ tet, das Fahrzeug stoppen und den... aufge‐ zeichnet und elektronisch ausgewer‐ tet werden. ● ● ● ● Bei Zündschlüssel im... Ende des Wischerhebels neu gestar‐ tet werden. Durchschnittsverbrauch Der Wert wird... laufendem Motor aktiviert wird, schal‐ tet das System je nach Umgebungs...ältnissen werden die Scheinwerfer eingeschal‐ tet. Fernlicht Zum Umschalten zwischen Fern... können die Warnblinker automatisch eingeschal‐ tet werden. Deaktivierung durch Drücken... eingestellt werden, dass sie aufleuch‐ tet, wenn die Seiten- und Heckt...öffnet werden oder konstant leuch‐ tet. Bei Schalter in mittlerer Stellung.... Die Klimaanlage kühlt und entfeuch‐ tet (trocknet) die Luft, sobald die... Hinweis Wenn die Klimaanlage eingeschal‐ tet wird, um die Temperatur herun... Die Klimaanlage kühlt und entfeuch‐ tet (trocknet), wenn die Außentempe...ässt das Menü oder schal‐ tet die Anzeige aus. 5 k : Verringert die... zu versetzen. Die Anzeigeleuchte leuch‐ tet auf. Bei Aktivierung des Wartungsmodus... den Motor automatisch neu star‐ tet. Füllmengen 3 235. Tankstelle 9 Gefahr Beim.... Bei zu niedriger Motordrehzahl schal‐ tet das Getriebe automatisch in einen.... Wenn die Zündung nicht ausgeschal‐ tet oder die Parkbremse nicht bet.... Deaktivierung Das Lastprogramm wird ausgeschal‐ tet bei: ● kg noch einmal dr... Drücken von Ø wieder eingeschal‐ tet. Kontrollleuchte Ø erlischt. Darüber hinaus... System ist deaktiviert und arbei‐ tet nicht. Die Deaktivierung wird da... den Motor automatisch neu star‐ tet. Füllmengen 3 235. Zum Tanken die...



Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
0.07/5
... an 68 Fussgänger getötet und 700 schwer verletzt. Fussg... Jahr 68 Fussgänger getötet und bfu-Sicherheitsdossier Nr. 11... ernstes Problem für die Fussgängersicherheit tet. Aufgrund der grossen Altersspannweite, d. h. dar... Strassenverkehrs- Kollisionen im Strassenverkehr getötet. Bei einer unfällen des... so viele Fussgänger getötet wie in der Unfalljahrs möglich... oder zur Kilometerleis- ger getötet. tung der Fussgänger im...änger werden 4 andere Verkehrsteilnehmende getötet. Das gleiche Verhältnis In...ältnis 1 zu 8 über 1200 getötet, sank ihre Anzahl bis heute...ähernd drei Viertel auf getötet. Schlechter sieht es mit einem... schweren gänger im Strassenverkehr getötet zu werden, Personenschäden bei... Fussgänger jährlich B NZ getötet und 700 schwer verletzt. Dazu...- Nutzer schwer verletzt und 2 getötet. 26 der Be- gänger. Pro... Körper, Übrige 0.15 0 Baustellenarbeiter getötet und 3 weitere schwer ten Baustellenbereich... Unfallgeschehen 49 verletzt oder getötet, 22 von einem Rechtsabbie- 6 %, dagegen... Lenkenden (Abbildung 10). Junge Lenker tet. An zweiter Stelle stehen Sachentransportfahr... Jahr 68 Fussgänger getötet und 700 schwer 70 % der... nehmen Beweglich- verletzt oder getötet als zu Fuss Gehende. keit... Risiko, in einem Unfall getötet zu von Belgien (6,7 %) [71]. werden... (Art. 17 Abs. 1 VRV). getötet wurden, so geht hervor, dass...ändig getrennt vom motori- getötet wurden. Doch ist aus diesen... Fussver- schwer verletzt oder getötet. Das Rettungspotenzi- kehrs in einer... bedarf es oder gar getötet haben. nach wie vor gezielter... dieser Fragestellung zeigen Überqueren getötet zu werden, auf Fussgänger... Jahr ƒ 68 Fussgänger getötet und 700 schwer verletzt. Fussg...