Ракетный блок. Mage-2. [Редактировать]

Найдено 570 документов по запросу «Mage-2». [Перейти к поиску]

Дата загрузки: 2017-02-23
Скачать документ
SANTA CRUZ BIOTECHNOLOGY, INC. MAGE-A2 (C-20): sc-324914 BACKGROUND ... LOCATION The melanoma-associated antigen (MAGE) family consists of a number of... recognized by cytotoxic T lymphocytes. The MAGE genes were initially isolated from... as targets for cancer immunotherapy. MAGE genes encode for tumor-rejection... in normal testis and placenta. MAGE-A2 (melanoma antigen family A2), also known as MAGE2, MAGEA2A, MAGE-A2B or CT1.2 (cancer/testis... acid protein that contains one MAGE domain. Expressed in a variety of... and head squamous cell carcinoma, MAGE-A2/2B is thought to... melanoma. Science 254: 1643-1647. MAGE-A2 (C-20) is recommended for detection of MAGE-A2 of human origin by...); may cross-reactive with MAGE-A3, MAGE-A6 and MAGE-A12. 2. Zakut, R., Topalian... Rosenberg, S.A. 1993. Differential expression of MAGE-1, -2, and -3 messenger RNA in transformed... of 12 genes of the MAGE family. Immunogenetics 40: 360-369..., A. 1995. The melanoma antigen gene (MAGE) family is clustered in the..., S., Mayer, R.J., Itoh, K. and Fujita, J. 2003. MAGE-A4 interacts with the liver..., S., Pierotti, M.A., Rodolfo, M. and Schneider, C. 2006. MAGE-A tumor antigens target p53 transactivation.... USA 103: 11160-11165. SOURCE MAGE-A2 (C-20) is an affinity... mapping at the C-terminus of MAGE-A2 of human origin. PRODUCT... control antibody for MAGE-A2 siRNA (h): sc-108018, MAGE-A2 shRNA Plasmid (h): sc-108018-SH and MAGE-A2 shRNA (h) Lentiviral Particles: sc-108018-V. Molecular Weight of MAGE-A2: 35 kDa. RECOMMENDED SECONDARY... regulation of the MAGE-A1, MAGE-A2, MAGE-A3, and MAGE-A12 gene promoters.... Cancer Res. 5: 749-759. Try MAGE-A (6C1): sc-20034, our highly recommended monoclonal alternative to MAGE-A2 (C-20). Also, for AC... Alexa Fluor® 647 conjugates, see MAGE-A (6C1): sc-20034. 9. Ries, J., Vairaktaris...

Дата загрузки: 2017-03-10
Скачать документ
... which is appl ied to i mage data, on a pixel-by-pixel... plex com b i na­ tions of i mage processi n g o perations. These va rious... ca n be s u m m a rized a s : -* i mage correcti o n i mage reg istration i mage e n h a nce m e nt i m age classificati... There a re t\YO aspects to i mage correcti on : ca l i bration a n d geometric... conve rt i n g the u n its i n :w h i c h the i mage data is stored t o m efm i n gfu... This covers a wide .range of i mage processi.n g tech n i q u es, i n cl u d i ng... u i re as m uch storage as i mage data of correspon d i n g resol uti... ng i nd ividual pixels. The i mage is now in a form where... a re ava i la­ ble for i mage e n h a ncement at this stage. These..., edge detection and other standard i mage processi n g faci l ities. 4.5 Comparison Database... contou rs from a sate l l ite i mage in identical format to the... p rovide a basis fo r com plex i mage com b i na­ tions, a n d a re designeq... for every pixel in the i mage. Thus, once a formu l a has been... u d i n g fi lteri ng, software zo'O m i n g , i mage masking and com b i nations of... of appl ication tasks S�nd i mage m a n i p u l a­ tions. Dialogue is enti rely... FRONTI E R S displays the composite radar i mage. I n Plate 1 , the yel l ow overlay... at the time of this i mage. The radar data a re pre... a n i ndivi d u a l rad a r a n d t o reconstitute t h e com posite i mage. The strength of radar echoes... the corrected rada r com posite i mage. The forecaster may mod ify... cloud, i ndicated in the visible i mage by the l i g hter b l u es, correspond... satell ite-derived ra i nfa l l i mage obta i ned from t h e previous a n a lysis... defi ne a window on the i mage, replay a seq uence, and with... tra nslational velocity to the i mage so that an indentified featu... and satel l ite derived rainfa l l i mage, but it has a coarser resol... is a need for rea l time i mage processing, display and contro l . To... the E DCS, so that an i mage of o n-board com m a n d i n g activity is... use of the m ost powerfu l i mage proces­ sing device ava i l a ble... i n c l u d e.resista nqe to fa u lts a n d d a mage, the a b i l ity to u se severa...

Дата загрузки: 2017-02-23
Скачать документ
... Design Patent (10) Patent N0.2 Mage (54) (75) (45) Date of...: SUNGLASS Inventor: - D204,210 S Jerome J. M. Mage, Los Angeles, CA (Us) _ - (73... Mage LutZ Leonardi Simioni Bernheiser Houston et al. Park Wilson Mage Mage Mage Mage Haslbeck Mage Mage Wilson Mage Mage Mage Hill McCausland Mage Simioni Boutboul et al. Mage Baharad... al. Lester Mage Flanagan Herman Mage Conway Fowler Hartman Dondero Mage Yee et.../2007 3/2008 3/2008 Mage Mage Mage Mage S 2/2003 Mage D565,085 S 3/2008 Mage S 9/2003 Mangum D565... S D581,449 S D488,499 S 4/2004 Mage D584,758 S D496,064 S D500... S D505,151 S 9/2004 Mangum 1/2005 Mage 5/2005 Windham D585,928 S D586... 6/2009 Yang ....................... .. D16/326 1/2009 Mage 2006/0268218 A1 4/2006 Teng... OTHER PUBLICATIONS _ 13534573 S 13534574 S 1/2007 Mage V2007 Lane Accessories, 1986, front... al. Daems et al. Arnette Mage Yee etal~ Domus, Oct. 1985...

Дата загрузки: 2016-12-29
Скачать документ
Research Article MAGE-A, mMage-b, and MAGE-C Proteins Form Complexes with KAP1 ... Suppress p53-Dependent Apoptosis in MAGE-Positive Cell Lines 1 1 1 1 1 Bing Yang... Abstract The MAGE-A, MAGE-B, and MAGE-C protein families comprise the class-I MAGE/cancer testes.... In addition to inducing apoptosis, MAGE suppression decreases KAP1 complexing with... of class I MAGE proteins also induces apoptosis in MAGE-A– positive, p53wt/wt... in a MAGE-A–positive HCT 116 p53À/À variant, indicating that MAGE suppression of apoptosis requires p53. Finally, treatment with MAGE-specific... syngenic DBA2 mice. Thus, class I MAGE protein expression may suppress apoptosis... in normal tissues, inhibition of MAGE antigen expression or function represents... of the MAGE family of proteins, including the MAGE-A, MAGE-B, and MAGE-C subfamilies, which... now called class I MAGE antigens (1, 2). Because many class I MAGE genes are highly... workers have shown that one MAGE molecule, MAGE-A2, binds to p53..., we used pan-MAGE-A monoclonal (Zymed Laboratories, Inc.), anti– MAGE-A1 monoclonal (Santa Cruz Biotechnology), anti–MAGE-B2 polyclonal... immunoprecipitation. Antibodies specific for mouse MAGE proteins expressed by the cells... of MAGE binding partners. The human MAGE-C2 (NM_016249, previously called MAGE-E1... or anti-MAGE antibody followed by immunoblotting with anti-MAGE or anti... immunoprecipitated with antiKAP1 antibody, and MAGE proteins were detected with anti... Software (Insightful). Results Suppression of MAGE genes inhibits tumor cell viability... melanoma cell lines that express MAGE-A and MAGE-C2 proteins, and with... transfection with siRNAs targeting several MAGE genes decreased cell viability compared... the human MAGE-A gene family or targeting the human MAGE-C2 gene..., mMage-b Figure 1. MAGE siRNAs inhibit melanoma growth in vitro. A, MAGE siRNA inhibits.... Pan-MAGE-A siRNA targets all human MAGE-A subfamily members except MAGE-A1, which... effect of siRNAs targeting individual MAGE-A family members. C, individual siRNA duplexes... variable results, indicating sequence specificity. D, MAGE siRNAs decrease expression of target... unique sequences in several individual MAGE-A family members also effectively inhibit... specifically suppress the targeted MAGE proteins. Suppression of MAGE genes induces apoptosis... morphologic analysis and found that MAGE siRNA induced significant apoptosis in... with flow cytometry confirmed that MAGE siRNAs caused apoptosis (Supplementary Fig... assay with MAGE-C2 as bait. KAP1 bound to MAGE-C2 in... was confirmed as an endogenous MAGE-C2 binding partner by coimmunoprecipitation... down KAP1 with endogenous MAGE-A using a pan-anti-MAGE-A antibody and that... truncated KAP1 proteins. Immunoprecipitation of MAGE-C2 followed by immunoblotting with... different MAGE proteins, including members each of the three class I MAGE families... a common function of class I MAGE molecules. MAGE proteins facilitate KAP1/p53 complex...), suggesting that MAGE binding facilitates Figure 3. MAGE-A, mMage-b, and MAGE-C proteins form complexes... with endogenous MAGE-A and MAGE-C2 proteins, and with expressed MAGE-A3 and... lysates were immunoprecipitated with anti–MAGE-C2 antibody. Top blot, immunoblotting... technique. *, P < 0.05, significantly different from MAGE-siRNA–transfected and control siRNA...; apoptosis data not shown). However, MAGE knockdown could not induce apoptosis... cells that are p53À/À. Furthermore, MAGE knockdown activated an integrated h-lactamase... and other malignancies. The anti–MAGE-A antibody we used for immunoprecipitation... using siRNAs specific for individual MAGE-A family members suggest that suppression... existence of multiple nearly identical MAGE family members enables a single critical... the p53À/À variant of HCT116. B, MAGE-A knockdown activates a b-lactamase reporter gene... mMage-b siRNA treatment. classes of MAGE proteins might explain this phenomenon... MAGE-MAGE binding or the formation of MAGE homodimers or heterodimers (22–24). MAGE... homology among the MAGE-A proteins and unlike other class I MAGE proteins has... agreement with previous studies showing MAGE-A1 has a different binding partner... function. Using immunoprecipitation of endogenous MAGE and immunoblotting, we were unable... specific MAGE proteins, including MAGE-A2, MAGE-A3, MAGE-A5, and MAGE-A6, mMage-b, and MAGE... our discoveries of MAGE suppression of apoptosis and MAGE binding to KAP1... tyrosine kinase promotes expression of MAGE genes by maintaining their promoter... mediated through regulation of MAGE expression and MAGE binding to KAP1. We... increased apoptosis in spermatocytes (36). MAGE proteins were the first cancer... unequivocally that inhibition of selected MAGE proteins can decrease the viability.... The cancertestis antigens CT7 (MAGE-C1) and MAGE-A3/6 are commonly expressed... cancer/testis (CT) antigens MAGE-A1, MAGE-A3, MAGE-A4, CT-7, and NY... M, Simonatto M, Peche LY, et al. MAGE-A tumor antigens target p53 transactivation... M, Hirohata M, Itoh K. Identification of MAGE-1 and MAGE-4 proteins in spermatogonia and primary...

Дата загрузки: 2017-01-04
Скачать документ
... defeat the foe before you? Mage Wars is the customizable strategy... foe while protecting your own Mage from destruction. Prepare to enter... written consent of the author. Mage Wars® is a registered trademark of... in this order. Learning Mage Wars Mage Wars was designed to be... need their Mage Ability card. When you setup your Mage status board... of Mage Wars is to kill the other Mage! Keep your Mage alive... ONE: APPRENTICE MODE APPRENTICE SPELLBOOKS Mage Wars allows you to play... SETUP QUICKCAST MARKER SPELLBOOKS MAGE CARD MAGE ABILITY CARD ACTION MARKER ATTACK... 322 Spell Cards 4 Mage Cards 4 Mage Ability Cards 2 Mage Status Boards 8 Status Cubes... STATUS CUBES (RED, BLACK) MAGE STATUS BOARD MAGE ABILITY CARD INITIATIVE MARKER... games. Setting Up the Game MAGE CARD QUICKCAST MARKER MANA COUNTERS... a Mage and takes the matching Mage Card and Ability Card for that Mage... 1 black quickcast marker. Place your Mage Card in the corner zone... a black status cube on your Mage’s starting Channeling, Mana Supply (all... game! DAMAGE COUNTERS MAGE ABILITY MARKERS EXAMPLE 1: apprentice Mage STATUS BOARD SET... Action Phases Final Quickcast Phase Mage Wars is played over a series... one Mage takes enough damage to be destroyed. The last Mage standing... an action marker (including your Mage). The action marker is used... the next Reset Phase). Your Mage also has a quickcast marker. You... the inactive side when your Mage takes their quickcast action. CHAPTER... time. Your Mage records his mana supply on your Mage status board... trait effects. Phase 5: Planning Each Mage prepares for the round by... you activate a creature (including your Mage), or immediately after you have... a friendly creature’s Action Phase, your Mage can use his special quickcast... define your Mage, and what he can do. In Mage Wars, spells... of the target. Note: Your Mage is a Level 6 creature. CASTING SPELLS... counters it. Discarding Spells Each Mage has his own separate discard.... Record damage to your Mage using your Mage status board, and record...). Corporeal & Incorporeal Normal objects, from a Mage’s wand to a Summoned angel, have... the Spawnpoint (instead of your Mage). The Spawnpoint must spend its... this enchantment is attached to a Mage, the reveal cost is increased.... If Harmonize is revealed on a Mage, the reveal cost is 4 (instead... the target. Using hidden enchantments, a Mage can build a web of diabolical.... EQUIPMENT Equipment spells give your Mage new or stronger abilities. Equipment... examine the equipment attached to a Mage at any time. Each equipment... spells have a range of “0-2”. Normally, a Mage will be casting equipment only... equipment item on another Mage, that Mage controls and can use the... is an important part of Mage Wars® tactics. Example: The Beastmaster... just half. The Mage Ability Card Each Mage comes with his own... need to know about your Mage: • Class: Beastmaster, Priestess, Warlock, or Wizard, each type of Mage has unique abilities and advantages... maximum amount of damage your Mage can take before being destroyed...: The amount of mana your Mage generates each round. Place a black... space of your Mage status board. • Subclass: Each Mage Ability card has.... Note, for all purposes, your Mage is a Level 6 creature. He also... unique to each Mage. Read the abilities for your Mage carefully, and... information is used when your Mage makes an attack. BEASTMASTER Beastmasters... SPELLBOOKS Training To truly experience Mage Wars, you need to create... you can explore many different Mage Wars strategies. Every player has... several different spellbooks for each Mage. Your Mage’s ability card tells you... of magic your Mage is trained in. Your Mage is trained in... in your first spellbook: • Equipment: Mage Wand, Elemental Wand, Moonglow Amulet... Link enchantment (which is Dark Mage Only.) Epic Spells: Spells that... be very useful to a Mage. Any Mage may purchase any Novice spell.... Beastmaster 1 Bearskin Armor 1 Elemental Cloak 1 Mage Wand 1 Regrowth Belt 1 Ring of... Ring 1 Deflection Bracers 1 Ivarium Longbow 1 Mage Wand 1 Moonglow Amulet 1 Ring of... Hauberk 1 Elemental Wand 1 Leather Boots 1 Mage Wand 1 Moonglow Amulet 1 Staff of... Priestess CHAPTER NINE: MULTIPLAYER MULTIPLAYER Mage Wars was designed for two... are affected by Incapacitation differently. A Mage’s mind is so powerful that... have the Living trait. Mage This creature is a Mage, and represents the... round. The Mage is a Level 6 creature. If your Mage is destroyed, you... this enchantment is attached to a Mage, the reveal cost is increased... objects which can cast spells. Mage Only Some spells are restricted to particular Mage classes. For example, a spell may... page 11. Quickcast Action Each Mage can take a special additional action..., Sean McCoy Rulebook/Box Art/Mage Art: Craig Spearing Interior Rules... (face-up). Channeling Phase Each Mage and object that channels adds.... 5 Planning Phase 6 Deployment Phase Each Mage chooses up to 2 spells from... creatures are finished acting, each Mage has a final opportunity to use... initiative. Once per round, each Mage may use his quickcast action...

Дата загрузки: 2017-03-09
Скачать документ
LE NOUVEL édito Niveau B2 Guide pédagogique C. Brillant V. Bazou R. Racine J.-C. Schenker Table des crédits textes p. 34 © Biba - Mondadori p. 48 Duchamp du signe de Marcel Duchamp © Editions Flammarion, 1994. p. 48 Petit Robert des noms propres 2010 p. 73 « Les professionnels du tourisme ont ressenti la crise », 27/07/2009, Delphine Nougairède, intervenants : M. Jean-Pierre Serra et M. Jean-Marc Coppola © Radio France p. 74 « Une virée dans l’espace » 10/12/2009, Ersin Leibovitch, intervenants : M. Jacques Monin, M. Richard Branson © Radio France p. 88 © Marianne 2 - Bernard Maris p. 88 © Marianne 2 - Isabelle Saporta p. 104 © Le Français dans le monde p. 124 Les Hommes et les Femmes…, La Première, « Entretien avec Christine Orban, écrivain », 13 février 2010 © Espace 2 - Radio Suisse Romande p. 163 © Elle p. 163 © Le Canard enchaîné p. 178 © Le Nouvel Observateur Nous avons recherché en vain les auteurs ou les ayants droits de certains textes et/ou documents reproduits dans ce livre. Leurs droits sont réservés aux Éditions Didier. Conception et direction artistique de la couverture : Christian DUBUIS SANTINI © Agence Mercure Principes de maquette pages intérieures et mise en page : Isabelle AUBOURG « Le photocopillage, c’est l’usage abusif et collectif de la photocopie sans autorisation des auteurs et des éditeurs. Largement répandu dans les établissements d’enseignement, le photocopillage menace l’avenir du livre, car il met en danger son équilibre économique. Il prive les auteurs d’une juste rémunération. En dehors de l’usage privé du copiste, toute reproduction totale ou partielle de cet ouvrage est interdite. » « La loi du 11 mars 1957 n’autorisant, aux termes des alinéas 2 et 3 de l’article 41, d’une part, que les copies ou reproductions strictement réservées à l’usage privé du copiste et non destinées à une utilisation collective » et, d’autre part, que les analyses et courtes citations dans un but d’exemple et d’illustrations, « toute représentation ou reproduction intégrale, ou partielle, faite sans le consentement de l’auteur ou de ses ayants droits ou ayants cause, est illicite. » (alinéa 1er de l’article 40) – « Cette représentation ou reproduction par quelque procédé que ce soit, constituerait donc une contrefaçon sanctionnée par les articles 425 et suivants du Code pénal. » © Les Éditions Didier, 2010 – ISBN 978-2-278-06730-5 – Dépôt légal : 6730/01 Achevé d’imprimer en avril 2010 par l’imprimerie JOUVE AVANT-PROPOS LE NOUVEL édito s’adresse à des étudiants adultes ou grands adolescents ayant acquis le niveau B1 du Cadre européen commun de référence pour les langues (CECR). Il couvre le niveau B2 du CECR et permet aux étudiants de se présenter au DELF B2. Profil de l’utilisateur/apprenant au niveau B2 : Écouter E nmbeblZm^nk(Ziik^gZgm% Zn gbo^Zn ;+% i^nm \hfik^g]k^ ]^l \hg_®k^g\^l ^m ]^l ]bl\hnkl Zll^s ehg`l ^m f°f^ lnbok^ ng^ Zk`nf^gmZmbhg \hfie^q^ lb e^ lnc^m enb ^g ^lm k^eZmbo^f^gm _Zfbeb^k' Be i^nm \hfik^g]k^ eZ ieniZkm ]^l ®fbllbhgl ]^ m®e®oblbhg lnk e Z\mnZebm® ^m e^l bg_hkfZmbhgl' Be i^nm \hfik^g]k^ eZ ieniZkm ]^l Ûefl ^g eZg`n^ lmZg]Zk]' Lire Be i^nm ebk^ ]^l Zkmb\e^l ^m ]^l kZiihkml lnk ]^l jn^lmbhgl \hgm^fihkZbg^l ]Zgl e^ljn^el e^l Znm^nkl Z]him^gm ng^ Zmmbmn]^ iZkmb\neb¯k^ hn ng \^kmZbg ihbgm ]^ on^' Be i^nm \hfik^g]k^ ng m^qm^ ebmm®kZbk^ \hgm^fihkZbg ^g ikhl^' Prendre part à une conversation Be i^nm \hffngbjn^k Zo^\ ng ]^`k® ]^ lihgmZg®bm® ^m ] ZblZg\^ jnb k^g]^ ihllb[e^ ng^ bgm^kZ\mbhg ghkfZe^ Zo^\ ng eh\nm^nk gZmb_' Be i^nm iZkmb\bi^k Z\mbo^f^gm ¨ ng^ \hgo^klZmbhg ]Zgl ]^l lbmnZmbhgl _Zfbeb¯k^l% ik®l^gm^k ^m ]®_^g]k^ l^l hibgbhgl' S’exprimer oralement en continu Be i^nm l ^qikbf^k ]^ _Z­hg \eZbk^ ^m ]®mZbee®^ lnk ng^ `kZg]^ `Zff^ ]^ lnc^ml k^eZmb_l ¨ l^l \^gmk^l ] bgm®k°m' Be i^nm ]®o^ehii^k ng ihbgm ]^ on^ lnk ng lnc^m ] Z\mnZebm® ^m ^qiebjn^k e^l ZoZgmZ`^l ^m e^l bg\hgo®gb^gml ]^ ]b__®k^gm^l ihllb[bebm®l' Écrire Be i^nm ®\kbk^ ]^l m^qm^l \eZbkl ^m ]®mZbee®l lnk ng^ `kZg]^ `Zff^ ]^ lnc^ml k^eZmb_l ¨ l^l bgm®k°ml' Be i^nm ®\kbk^ ng ^llZb hn ng kZiihkm ^g mkZglf^mmZgm ng^ bg_hkfZmbhg hn ^g ^qihlZgm ]^l kZblhgl ihnk hn \hgmk^ ng^ hibgbhg ]hgg®^' Be i^nm ®\kbk^ ]^l e^mmk^l jnb f^mm^gm ^g oZe^nk e^ l^gl jn be Zmmkb[n^ i^klhgg^ee^f^gm Znq ®o®g^f^gml ^m Znq ^qi®kb^g\^l' COMPRENDRE PARLER ÉCRIRE Cadre européen commun de références pour les langues, p. 27. LE NOUVEL édito est composé d’un livre de l’élève contenant un CD et un DVD et d’un guide pédagogique. Le livre de l’élève comprend : – un tableau détaillé des contenus ; – dix unités, chacune centrée sur un thème (1 Médias à la une, 2 C’est dans l’air !, 3 Les arts en perspective, 4 Les nouveaux voyageurs, 5 Grandeur nature, 6 L’histoire en marche, 7 Je l’aime, un peu, beaucoup…, 8 Ressources humaines, 9 À la recherche du bien-être, 10 Le français dans tous ses états) ; – des annexes contenant un mémento grammatical, des conseils pour la production écrite, les transcriptions des documents du CD et du DVD et les corrigés des exercices...

Дата загрузки: 2017-03-10
Скачать документ
... structure des revenus : le chômage est devenu un fait social... monde du travail. Le chômage est devenu une réalité sociale... travail : le taux de chômage a diminué jusqu’à 8,9 % en 2001. En même temps le chômage enregistré ne dépasse pas 2 % en... distinction des chiffres du chômage au sens du BIT et du chômage enregistré est une particularité du... contemporaine. Les chiffres du chômage ne sont pas très élev... 1 Il s’agit ici du chômage au sens du BIT. 505... chômage. En Russie on a préféré substituer au gigantesque chômage potentiel... de la population, un chômage officiel modéré et une énorme...ès bas de l’allocation de chômage et au développement insuffisant du... les familles nombreuses. Le chômage est un facteur de privation... 40-59 ans. Le chômage et le niveau modeste de..., touchées par le chômage, les familles monoparentales et les..., touchées par le chômage, les familles monoparentales. Pour la... « frères–sœurs ». Le chômage massif n’est pas toujours enregistr...

Дата загрузки: 2017-01-10
Скачать документ
... 61-65 www.iosrjournals.org MAGE Genes mRNAs: Potential Early Diagnostic... sex matched healthy control subjects. MAGE-1 mRNA was expressed in the... 9(40.9%) patients with metastatic HCC. MAGE-3 mRNA was expressed in the....1%) patients with metastatic HCC. Also, MAGE-4 mRNA was expressed in the... expression of any MAGE mRNAs. In conclusions, MAGE-1, MAGE-3 and MAGE-4 may be promising... metastasis of HCC cells. Keywords: MAGE-1, MAGE-3, MAGE-4, HCC I. Introduction Infection by hepatitis... www.iosrjournals.org 61 | Page MAGE GenesmRNAs: Potential Early Diagnostic Markers... than HCC [12]. The human MAGE genes are on the X chromosome... loci named MAGE-A (12 genes, Xq28), MAGE-B (4 genes, Xq21.3) and MAGE-C (1 gene, Xq26). Also, a fourth human MAGE gene... locus was isolated and named MAGE-D. This gene was located in... the numerous numbers of isolated MAGE genes, their physiological function in... [14]. The MAGE-A subfamily comprises 12 genes (MAGE-A1 to MAGE-A12) which... for testis and placenta. The MAGE-A genes are of particular interest... are strictly tumor specific. MAGE-1 is a member of MAGE-A genes that is... ovarian tissue in premenopausal women. MAGE-1 is highly expressed in small... AFP-negative patients [15]. MAGE-3 belongs to MAGE-A gene family and is... of great interest. Detection of MAGE transcripts in peripheral blood mononuclear...) had been carried out for MAGE-1, MAGE-3 and MAGE-4 mRNAs to evaluate their... www.iosrjournals.org 62 | Page MAGE GenesmRNAs: Potential Early Diagnostic Markers.... 2.2.5. RT-PCR Detection of MAGE-3 and MAGE-4 mRNA were done according to... final extension at 72oC for MAGE-1 and MAGE-3 and 94oC for 30s... min of final extension for MAGE-4. The PCR products were separated... AFP exhibited detectable concentrations of MAGE-3and 4 mRNAs more often than... is no significant difference. MAGE-1, MAGE-3 and MAGE-4 mRNAs were positively expressed in... expression (i.e. Expression of MAGE-1 and/or MAGE-3 and/or MAGE-4) in patients with....3%(8/22). The patients who had MAGE-3 or MAGE-4 mRNAs (n= 5) in their peripheral... injection (n = 3) and selective chemoembolization (n = 1). MAGE-1, MAGE-3 and MAGE-4 mRNAs were positively expressed in.... Also combined expression results of MAGE-1, MAGE-3 and MAGE-4 mRNAs in the peripheral... or lymph nodes [21, 22]. MAGE gene transcripts have been regarded... of cancers [23]. The MAGE-3 and MAGE-4 genes are members of the.... It has been reported that MAGE-3 and MAGE-4 mRNAs are positive in... tissue, but there is no MAGE expression in peri-cancerous tissue... cells by RT-PCR of MAGE-1, MAGE-3 and MAGE-4 transcripts and to combine... the positive rate of expression MAGE-1, MAGE-3 and MAGE-4 mRNAs were significantly increased... MAGE type (MAGE-4 and MAGE-3 respectively). While none of them were positive for (MAGE... expression of MAGE-1, MAGE-3 or MAGE-4 mRNAs in their peripheral blood. MAGE-1was expressed... www.iosrjournals.org 63 | Page MAGE GenesmRNAs: Potential Early Diagnostic Markers... with metastatic HCC. Expression of MAGE-3 mRNA was detected in the... et al. who found that MAGE-1and MAGE-3 was expressed in 14... Mou et al. reported that MAGE-3 was expressed in 33.3% in... 53.3% in HCC tissues [24]. MAGE-4 mRNA was expressed in the.... Tahara et al. reported that MAGE-4 mRNA was expressed in 18..., Tsuzurahara et al. showed that MAGE-4 protein was significantly increased in...]. Combined expression results of MAGE-1, MAGE-3 and MAGE-4 mRNAs in the peripheral blood..., by combined expression results of MAGE-1, MAGE-3 and MAGE-4 mRNAs in the peripheral... MAGE1, MAGE-3 or MAGE-4 mRNA respectively. So, combining detection of MAGE-1, MAGE-3 and MAGE-4 mRNAs... the positive rate of expression MAGE genes is markedly increased in... of occurrence of metastasis. So MAGE-1, MAGE-3 or MAGE-4 mRNA expression in peripheral... cancer-specific multi-marker assay.MAGE-1, MAGE-3 and MAGE-4 were found to be...–63. Baker PA, Salehi A. The MAGE proteins: emerging roles in cell... MI and Elsawy WH. MAGE-3 and MAGE-4 genes as possible markers for... Ribonucleic Acid Homologous to Human MAGE-D is Strongly Expressed in Rat... T, Dawson S, Mayer RJ, et al. MAGE-A4 interacts with the liver... Heidar MM: Multiple molecular markers MAGE-1, MAGE-3 and AFP mRNAs expression nested.... www.iosrjournals.org 64 | Page MAGE GenesmRNAs: Potential Early Diagnostic Markers... H, Yamano T, et al. Expression of MAGE-1 and -3 genes and gene products... in human of expression of MAGE hepatocellular carcinoma. Liver.19, 1999... Y, Kitano S, Makuuchi M. Expression of the MAGE gene family in human hepatocellular... SawyWH,El-TarhounySA,Bayomy, ESandRaafat N.MAGE-4 gene m-RNA and TGF in..., et al. Evaluation of MAGE-1 and MAGE-3 as tumour-specific markers to... M, Tanikawa K, et al. Detection of MAGE-4 protein in the sera of... primers for PCR amplification MAGE mRNAs Gene MAGE-1 MAGE-3 MAGE-4 The primer Sense, 5´-TAGAGTTCGGCCGAAGGAAC...-3´. Table (4) Expression of MAGE-1, MAGE-3&MAGE-4 mRNAs enrolled groups MAGE-1 MAGE-3 MAGE-4 Combined* Control group (n = 30...

Дата загрузки: 2017-01-23
Скачать документ
... focussed against peptides derived from MAGE proteins and was increased within.................................................... 130 4.3.6 Reactivity of clones to MAGE-A3 transfected cell lines ........................................ 132... 4.3.9 Investigation of clone responses to MAGE-A3 ...................................................... 146 4.4 T cell responses to... on peptides derived from the MAGE family of proteins................................. 164 4.4.6 Detection... CD4+ T cell clone responses to MAGE-A3 transfected cell lines .......................... 134... responses to transfected LCLs and MAGE-A3 expressing tumour cell lines... clones generated by stimulation with MAGE-A3 transfected & non-transfected cell... overlapping peptides and full-length MAGE-A3 protein147 Table of Figures... RuH189PM ...................... 173 Figure for MAGE-A expression by immunohistochemistry ................................ 175 Figure... offers a potential for immunotherapy. The MAGE family of CTAgs are examples... antigen was named MAGE-1, which was subsequently renamed MAGE-A1. A similar strategy... resulted in the identification of MAGE-A3, followed by BAGE and..., is not well understood. Both MAGE and GAGE families have been..., particularly in melanoma patients using MAGE-A3 or NY-ESO-1. Around...% of patients vaccinated with either MAGE-A3 peptide recombinant virus, or... and III trials of recombinant MAGE-A3 protein vaccines in melanoma... expressed in MM such as MAGE, LAGE and NY-ESO (PellatDeceunynck... CTAgs including RAGE-1, MAGE-C1, MGEA-6, GAGE-3, and some MAGE-A family members... a staining rack and 10µg/ml MAGE antibody (Invitrogen) or IgG2a isotype... post allograft Negative control A 0.01% C MAGE-A2-212-220 B 0.09% D CD8... AML allograft patient SS238PM when MAGE-A3 peptide GDNQ-batch 1 was... previously been shown to express MAGE-A3 (Pellat-Deceunynck et al... T cells recognising and responding to MAGE-A3 expressed by the cell... were co-cultured with the MAGE-A3 expressing myeloma cell line... able to recognise naturally expressed MAGE-A3 or required surface peptide... potential reactivity to naturally expressed MAGE-A3 on U266 could have... of clones to MAGE-A3 transfected cell lines MAGE-A3 transfected LCLs...-batch 1 peptide and endogenously expressed MAGE-A3 protein. CD8+ T cell clones... ascertain whether they could recognise MAGE-A3 transfected cell lines. It... was no recognition of this MAGE-A3 expressing cell line without... CD4+ T cell clone responses to MAGE-A3 transfected cell lines In... 1 were screened for reactivity against MAGE-A3 transfected LCLs by IFN..., which had been transfected with MAGE-A3. Non-transfected DESA and... the clones could recognise endogenous MAGE-A3 antigen. 135 Chapter 4: Detection... responses to transfected LCLs and MAGE-A3 expressing tumour cell lines... partially HLA-matched VACH LCLs. MAGE-A3 transfected and non-transfected... or 1500 pg/ml against MAGE-A3 transfected and non-transfected... clones still responded to the MAGE-A3 transfected DESA cell line... that they would recognise the MAGE-A3 transfected line, but it... and used to stimulate T cells. MAGE-A3 transfected variants (VACH-M3... clones generated by stimulation with MAGE- A3 transfected & non-transfected cell... 4.3.9 Investigation of clone responses to MAGE-A3 In an attempt to... (data not shown). Full-length MAGE-A3 protein was kindly supplied... VACH-EBV loaded either with MAGE-A3 whole protein, AGIL peptide... to the whole MAGE-A3 protein (labelled VACH-EBV+MAGE-A3). Therefore... overlapping peptides and full-length MAGE-A3 protein In order to... be specific for a peptide within MAGE-A3, previously characterised clones were... spanning the entire length of MAGE-A3, which were arranged in... with full length MAGE-A3 protein by IFN-γ ELISA (B). MAGE-A3 transfected... loaded with either full-length MAGE-A3 protein or CMV peptide... the T cell response (y-axis) to MAGE-A2/3 peptide EGDC over time...-γ capture. CD8+ T cells responding to MAGE peptides ALKD/EADP were detected... on peptides derived from the MAGE family of proteins and four... against peptides derived from the MAGE subfamily proteins A1, A2, A3... stimulated for 20 hours with MAGE-A2/A3 peptide EGDC. Antibodies... there was T cell immunity to MAGE family proteins in certain patients, an antibody to MAGE-A was used to investigate expression... anti-MAGE antibody (Invitrogen, Paisley, UK). A positive control of a known MAGE expressing... X30 X30 Figure for MAGE-A expression by immunohistochemistry Slide mounted... an antibody specific for the MAGE-A family of CTAg proteins (C). Testis samples, which naturally express MAGE-A3, were also stained with the isotype (B) and MAGE-A antibody (D). 175 Chapter 4: Detection of... account for the lack of MAGE antibody staining in the immunohistochemistry... derived from MAGE proteins. Although some studies found that MAGE was not... al., 2007). The fact that MAGE expression is highly restricted to... is likely to dictate that MAGE-specific immune responses are manifest... for the first time that MAGE family proteins are immunogenic in...

Дата загрузки: 2017-01-23
Скачать документ
... and Alternative Splicing of the MAGE-A Family of Cancer/Testis Antigens... — Gene organization — Exon–intron structure — MAGE-A family — CT-antigens Correspondence to... the corresponding genes form a larger MAGE (for ‘‘melanoma antigen’’) superfamily (Chomez.... 2002). Genes from MAGEA, MAGE-B, and MAGE-C families are expressed in germ... genes from the remaining MAGE families, most notably MAGE-D (Lucas et al... the MAGE-A locus. Boldface arrows: MAGE-A genes. Long arrows: inverted repeats. All MAGE... MAGE families (MAGE-B, MAGE-G, MAGEH), whereas coding regions of genes from the MAGE-C and MAGE... chromosome X, with the largest families MAGE-A, forming a locus at q28 (De... very narrow expression pattern, whereas MAGE-D genes contain numerous introns, are... appearance of alternative splicing of MAGE-A genes should have happened after... genome. The orthologous mouse family MAGE-A consisting of seven active genes... and in testis. Human MAGE-A and mouse Mage-a proteins form two separate... analyze alternative splicing of the MAGE-A genes using mapping of available... Fig. 2. Phylogenetic trees of the MAGE-A family. a Proteins. b Aligned 1800-nucleotide... the protein-coding regions of MAGE-A genes. Bootstrap support is shown.... Results Genes The locus containing MAGE-A genes spans about 3 Mb of... recent duplications: inverted duplication of MAGE-A9 and the adjacent region... 1. Tissue specificity of MAGE-A gene expression MAGE-A Tissue (organ) Testis Chronic... of the region between MAGE-A3/6 and MAGE-A2, forming sublocus II... case the duplicated genes MAGE-A3 and MAGE-A6 are very similar... less similar than the MAGE-A9 and MAGE-A2 (having only 8 substitutions... different names for MAGE-A3 and MAGE-A6 and consider them separately, whereas variants of MAGE-A2 and MAGE... (called subfamily I) contains MAGE-A8, MAGE-A9, MAGE-A10, and MAGE-A11. The second one (subfamily II) contains two pairs, MAGE-A3/ MAGE-A6 and MAGE-A2/MAGE-A12 (the former... the three remaining genes, MAGE-A1, MAGE-A4, and MAGE-A5, is weakly... a cluster, MAGE-A8 is clustered with MAGEA4 and MAGE-A1, and MAGE-A5... correlates with the phylogenetic trees. MAGE-A12 is located between two... of MAGE-A2, which in turn are framed by MAGE-A3 and MAGE-A6 (Fig. 1). Similarly, MAGE-A11 is located between two copies of MAGE-A9, and MAGE-A8 is immediately downstream... containing the remaining genes (including MAGE-A10 from the same subfamily... exon–intron structure of the MAGE-A genes. Boxes: exons. Thick lines... exon in MAGE-A4 (double-dotted vertical line in MAGE-A4: the...; the main MAGE-A6 isoform and two major MAGE-A4 isoforms were... of subfamilies: a deletion in MAGE-A3 and MAGE-A6 and two likely...). The upstream site in MAGE-A3 and MAGE-A6 has been created... region well alignable throughout the MAGE-A family contains four groups of... isoforms of all genes, excluding MAGE-A12, where two deletions remove... the main one in MAGE-A3 and MAGE-A6 and a site down... E2 was observed in MAGE-A2, MAGE-A9, MAGE-A10, and MAGEA8, although... shown). The acceptor site in MAGE-A8 corresponds to a well-alignable... of genes from subfamily I, MAGE-A10 and MAGE-A11, and a pair of... 3 in MAGE-A8. Notation as in Figs. 4 and 5. MAGE-A2 and MAGE-A12... a slightly weaker donor site) and MAGE-A9 (which is basically indistinguishable... by a long deletion in MAGE-A3 and MAGE-A6, and this deletion... acceptor sites in MAGE-A2, MAGEA12, MAGE-A10, and MAGE-A11 (exons 4, 4a... in position )3 (Fig. 7b). Finally, a MAGE-A10-specific alternative acceptor site... homologous (Table 2). In MAGE-A2, MAGE-A12, MAGE-A8, and MAGE-A10 these exons... to (6) Donor site consensus, aagGTgaga MAGE-A8 MAGE-A9 1* 1 2 3* 1* 1 2* 1 2 3 4 5* 6* 7* 8* 9* 10 11* 12... gggctgtgtgtgaaggaaaggtgagg aggctctgtgagaagacaaggtgaga aggctccgtgaggaggcaaggtaaga aggctccgtgaggaggcaaggtaaga MAGE-A10 MAGE-A11 MAGE-A4 Init. Init. Init.... ex. i8 MAGE-A1 MAGE-A5 MAGE-A3 MAGE-A6 MAGE-A2 MAGE-A12 Note. The... in MAGE-A8 and MAGE-A10, and not in MAGE-A9 and MAGE-A11... start exons. a MAGE-A2 and MAGE-A3. b MAGE-A2 and MAGE-A12. Notation as... in MAGE-A10 and MAGE-A11, used in most cases in MAGE-A2, and rarely used in MAGE-A12). On... minor isoforms in MAGE-A2 and MAGE- A10. Exon 3 of MAGE-A8 is... initial exon of MAGE-A10 to exons 1 and 0 of MAGE-A5; there... coding region. Thus created pre-MAGE-A was subject to several independent... mouse and other families of MAGE/Mage genes will show how common... particularly interesting to analyze the MAGE-B family, where the human and... the phylogenetic tree, and the MAGE-D family, whose members are highly... T (1998) Identification of a new MAGE gene with tumorspecific expression by... Lucas S, Brasseur F, Boon T (1999) A new MAGE gene with ubiquitous expression does...) MAGE-B5, MAGE-B6, MAGE-C2, and MAGE-C3: Four new members of the MAGE...) Isolation and characterization of a new MAGE gene family in the Xp21... ubiquitously expressed member of the MAGE superfamily. Gene 267:173–182...