Ракетный блок. Epsilon PBS. [Редактировать]

Технические характеристики

#ХарактеристикаЗначение
1Длина, метра1.5
2Тяга (пустота), кНьютон0.4
3Удельный импульс, сек215
4Масса, кг300
5Диаметр, метра1.2
6Типгидразин

Найдено 157 документов по запросу «Epsilon PBS». [Перейти к поиску]


Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
0.04/5
... findings including expression of 14-3-3 epsilon protein. Global comparative gene expression... signalling and responses. The 14-3-3 epsilon protein was chosen for follow... for binding partners of 14-3-3 epsilon. Two ATP synthase subunits, one..., mass spectrometry, Western blotting (14-3-3 epsilon, Sdha, Pebp1, Atp5b and Bad...) 103 Page 9 3.7 Studies of 14-3-3 epsilon 3.7.1 Validation of experiments using samples... of cell death (Bad) 3.7.3 14-3-3 epsilon pull-down assay 3.7.3.1 Bait protein... 6.2.4 Summary 220 7. Studies of 14-3-3 epsilon and Bad proteins 252 7.1 Validation... search results from the 14-3-3 epsilon pulldown analysis APPENDIX 10: Manuscript... Figure 4.8 Western blots of 14-3-3 epsilon (14-3-3ε), succinate 141 dehydrogenase (Sdha... (WB) analysis (right) for 14-3-3 epsilon (14-3-3ε), succinate dehydrogenase (Sdha), and... Figure 7.1 Western blots of 14-3-3 epsilon (14-3-3ε), succinate dehydrogenase (Shda), and... 10-18 (right) for 14-3-3 epsilon (14-3-3ε), succinate dehydrogenase (Sdha), and...-PAGE of the preliminary 14-3-3 epsilon pull-down assay Figure 7.5 Band... eluate from the preliminary 14-3-3 epsilon pull-down assay Figure 8.1 Mitochondrial... analysis. Specifically, antibodies for 14-3-3 epsilon (14-3-3ε), succinate dehydrogenase (Sdha), phosphatidylethanolamine... Page 106 3.7 Studies of 14-3-3 epsilon 3.7.1 Validation of experiments using samples... room temperature on a shaker. 3.7.3 14-3-3 epsilon pull-down assay A pull-down... 60µg of His-tagged 14-3-3 epsilon protein and a protein lysate prepared... synthase subunit beta 14-3-3 protein epsilon Cytochrome b-c1 complex subunit 6 ATP...-4A chain Others 14-3-3 protein epsilon 40S ribosomal protein SA Adenylyl... narrow-range 2DE experiments. 14-3-3 epsilon and the mitochondrial protein Sdha... to verify this analysis.  14-3-3 epsilon (14-3-3ε) An assay using a rabbit... Figure 4.8 Western blots of 14-3-3 epsilon (14-3-3ε), succinate dehydrogenase (Sdha), and...) analysis (right) for 14-33 epsilon (14-3-3ε), succinate dehydrogenase (Sdha), and..., ns = not significant. 14-3-3 epsilon (2DE) 14-3-3 epsilon (WB) One way ANOVA... 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide CAP, adenylate cyclase-associated... molecular chaperone related to the epsilon isoform found in our dataset... 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide desmin WD repeat domain... synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit 2 Cytoplasm transporter ATP5O ATP... protein kinase C, beta protein kinase C, epsilon superkiller viralicidic activity 2-like (S. cerevisiae... Glut-4, D-glucose and protein kinase C epsilon (Prkce). Glut-4 as a major hub...) interferon, gamma -immunoglobulin heavy constant epsilon interleukin 13 lectin, galactoside-binding.... Page 251 7. Studies of 14-3-3 epsilon and Bad proteins 7.1 Validation experiments... MI associated decrease in 14-3-3 epsilon observed in samples 1-9 was not...-3-3ε). Figure 7.1 Western blots of 14-3-3 epsilon (14-3-3ε), succinate dehydrogenase (Shda), and... 10-18 (right) for 14-3-3 epsilon (14-3-3ε), succinate dehydrogenase (Sdha), and... = not significant. 14-3-3 epsilon (10-18) 14-3-3 epsilon (1-9) One way ANOVA = 0.0006...-PAGE of the preliminary 14-3-3 epsilon pull-down assay A) & B) Two SDS... eluate from the preliminary 143-3 epsilon pull-down assay A) Bait flow... 14-3-3 protein epsilon BWB21 14-3-3 protein epsilon BWB22 14-3-3 protein epsilon Cytochrome c1, heme BWB24 protein, mitochondrial (mouse) 14-3-3 epsilon 14-3-3 epsilon 47kDa... confirmed the changes in 14-3-3 epsilon (Ywhae/14-3-3ε) expression, this is... afforded cardioprotection One protein, 14-3-3 epsilon is a very good candidate for... under investigation and although 143-3 epsilon is suggested to have early... proteomic analysis of protein kinase C epsilon signaling complexes in the normal... cardioprotection: Interplay between protein kinase C epsilon and delta in regulating glucose... NO RESULT 14-3-3 protein epsilon 14-3-3 protein epsilon 1430 1705 1705 2119... ATPB_RAT RSSA_RAT RSSA_RAT 14-3-3 protein epsilon Cationic trypsin precursor peptides only... repeat-containing protein 1 14-3-3 protein epsilon Abbrev. RefSeq ACCESSION UniProtKB/ Swiss.... similar to High affinity immunoglobulin epsilon receptor gamma-subunit precursor (FceRI... search results from the 14-3-3 epsilon pull-down assay Band identification... 1433E_RAT NO RESULT 14-3-3 protein epsilon 1549 106 Rattus 29155 4.63... 1433E_RAT 1433E_RAT 14-3-3 protein epsilon 14-3-3 protein epsilon 1779 337 19 31... BWB01 BWB01 1433E_RAT 14-3-3 protein epsilon 282 4 Rattus 29155 4.63 18... NO RESULT 14-3-3 protein epsilon 14-3-3 protein epsilon APPENDIX 9: continued Queries Species... 1433E_RAT 14-3-3 protein epsilon 14-3-3 protein epsilon 14-3-3 protein epsilon MASCOT Score 103... BWB25 BWB26 1433E_RAT 14-3-3 protein epsilon 1263 17 Rattus 29155 4.63... to PBS. The expression of two proteins (Shda and 14-3-3 epsilon) were... of expression levels of 14-3-3 epsilon with the normalized volumes shown... 6.15 Protein name 14-3-3 protein epsilon 40S ribosomal protein SA Adenylyl...



Дата загрузки: 2017-06-16
Скачать документ
Скачать текст
0.2/5
... replication PAGE Polyacrylamide gel electrophoresis PBS Phosphate buffered saline Pc Polycomb... in 1mL Phosphate Buffered Saline (PBS)/ 1mM MgCl2 /0.5mM CaCl2. The... were then fixed in 3% w/v paraformaldehyde/ PBS for 10 minutes, then washed 3 times in PBS. The cells that were transiently... washed 2 times in 100mM Glycine/ PBS for 10 minutes then washed 3 times in PBS. At this point the coverslips could be stored in PBS at 4C overnight. The cells were washed once in 0.2% TritonX-100/PBS for 10 minutes, then washed 3 times in 109 PBS. The cells were washed 3 times in 0.2% Bovine Serum Albumin (BSA)/PBS over a 5 minute period. The primary... was then added in 0.2% BSA/PBS for 45 minutes, then cells were washed 3 times in 0.2% BSA/PBS, over a 5 minute period. The secondary... at a 1/500 dilution in 0.2% BSA/PBS and incubated in darkness for... 3 times in 0.2% BSA/PBS, then washed twice in PBS. The coverslips were... pellet was resuspended in 100L PBS and freeze 110 thawed 3 times... cells were then washed in PBS, repelleted, then lysed in 200... pellet was then washed in PBS and repelleted. The cell pellet... an appropriate amount of 113 PBS and an equal volume of... milk powder, 0.1% Tween 20 in PBS) at RT for 1 hour. The... washed in 0.1% Tween 20 in PBS in between blocking and addition... washed twice in approximately 15mL PBS, then SDS lysis buffer added... washed twice in approximately 15mL PBS. The cells from each plate were then scraped into 2mL PBS, transferred to a 50mL Falcon tube... extracts Cells were scraped into PBS and are pelleted by centrifugation... removed and cells washed in PBS, then 5mL of lysis buffer... scraping the cells directly into PBS. The cell extracts were then... Ht31 (40) 316.AAC50431 Dystrobrevin-epsilon (40) 317.5VW21_HUMAN Microtubule-actin... adaptor-related protein complex AP-4 epsilon subunit (35) 380.S71752 giant...), 37 (9%) 425.S31975 14-3-3 protein epsilon, renal – mouse, 37 (12%) 426....Q96P05_HUMAN Transient receptor potential channel 4 epsilon splice variant (Transient receptor potential...), 37 (9%) 233.S31975 14-3-3 protein epsilon, renal – mouse, 37 (12%) 234....Q96P05_HUMAN Transient receptor potential channel 4 epsilon splice variant (Transient receptor potential...



Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
0.08/5
... (experiment III, Section 5.2.2.5). .......................................................................................... 174 Figure 6.1: PBS and β-casein wash protocols for... ABBREVIATION DEFINITION P450 Cytochrome P450 PBS Phosphate buffered saline PCIS Precursor..., powdered phosphate 86 buffer saline (PBS) sachets, sodium chloride, sodium dodecyl... liver sections were homogenised in PBS containing EDTA-free proteinase inhibitor... microsomal pellet was resuspended in PBS, 10% glycerol. 87 The protein... used immediately. Homogenise tissue in PBS, EDTA-free proteinase inhibitor cocktail... x g, 1 hour, 4°C Supernatant Pellet Resuspension in PBS, 10% glycerol Figure 3.1: Differential centrifugation... of primary antibody in PBSB (PBS, 0.05% Brij 35) over 1 hour... for downstream analysis, for example PBS, urea or SDS-PAGE loading... decreased activity from microsomes in PBS, indicating that sodium cholate negatively... protein using liver microsomes in PBS (Figure 4.9A), in the presence... of mouse liver microsomes in PBS (Figure 4.9A) showed good recovery... concentrations of methanol, ethanol, and PBS, as well as a mixture of... with β-casein (1% w/v in PBS, 500µl beads) or PBS (250µl beads) for 30... with 10 times volume of PBS. Further blocking experiments involved additional... with β-casein (1% w/v in PBS, 500µl beads) or PBS (250µl beads) for 2 hours... were then incubated with PBS for 2 hours creating PBS only and pre... of beads pre-incubated with PBS (250µl) or β-casein (250µl) were.... A B C PBS PBS β-casein β-casein Microsomes Microsomes PBS β-casein Microsomes PBS Microsomes β-casein D Figure 6.1: PBS and...) (section 7.2.2.2) were re-equilibrated with PBS. Mouse liver microsomes (400μl, 30mg... to FT1 and a further 500µl PBS was added to the apparatus... B CLCB_MOUSE 25.2702 - - - - Coatomer subunit epsilon COPE_MOUSE 34.7735 - - - Cytochrome b5... (Mouse) T-complex protein 1 subunit epsilon (TCP-1-epsilon) (CCT-epsilon) - Mus musculus (Mouse) T-complex... B Coatomer subunit alpha Coatomer subunit epsilon Complement C3 Cytochrome b5 Cytochrome...



Дата загрузки: 2017-02-23
Скачать документ
Скачать текст
Скачать перевод
Посмотреть билингву
0.16/5
SSC14-P3-2 Epsilon Launch Vehicle - First Flight and ...-5210, Japan ABSTRACT The first Epsilon launch vehicle was successfully launched... (USC) on September 14th, 2013. Epsilon has achieved full mission success... planned orbit with high accuracy. Epsilon is now ready to offer... describes the main features of Epsilon launch vehicle, its mission profile... development plan is presented, as Epsilon has to become more cost... the result of Epsilon maiden flight qualification analysis. Epsilon launch vehicle is... small payloads. The purpose of Epsilon is to provide small satellites... efficient launch system are focused. Epsilon development was carried out with... integrator. The launch site for Epsilon is JAXA’s Uchinoura Space Center..., 3-hour flight from Tokyo. © JAXA Epsilon is able to carry 1.4 tons... Post Boost Stage (PBS). Figure 1: Epsilon Maiden Flight. Epsilon has two line-ups... the low end type without PBS. On the other hand, the... is the standard configuration plus PBS. The basic configuration is illustrated... The PBS is one of the liquid propulsion systems in Epsilon as.... Payload Fairing Liquid Propulsion System (PBS) (Optional Stage) Third Stage (KM... Diagram of PAF introduced to Epsilon system with ample and well... Configuration: 3 stages only Optional Configuration: PBS added to Standard Configuration vehicle... flights. Figure 2: Configuration of Epsilon Vehicle Epsilon launch vehicle is 24 m tall... well flight-proven H-2A’s ones. Epsilon has an autonomous check-system... 1 shows essential specifications of Epsilon of maiden flight. 2. EPSILON LAUNCH VEHICLE Table... 1: Epsilon’s Essential Specifications For Maiden Flight. Stage 1st 2nd 3rd PBS Specification...] Isp (Vac) [s] 4. MAIDEN FLIGHT RESULTS Epsilon’s first flight was successfully conducted... the solid propulsion phase, the PBS firing was conducted twice, which... firing of 50N thrusters x 4 on PBS. The purpose of Phase-A and... burn-out 3rd motor/PBS separation PBS phase-A start PBS phase-B start Satellite... high accuracy orbit insertion by Epsilon. Table 3: Separation Conditions Item Alt... liquid fuel, which reserved in a PBS fuel tank for CCAM sequence... to provide a safe distance between PBS and spacecraft), the launch vehicle... capture this market. The current Epsilon launch vehicle is able to... 2020, We intend to extend Epsilon’s capabilities to 2 tons from current... 2 tons. So if the future Epsilon’s capability is extended to 2 tons... 6 shows the Epsilon family under study. To expand the Epsilon capability with... boosters, and with more powerful PBS. Figure 5: Dynamic Longitudinal Acceleration under...-A. This result is indicated that Epsilon’s mechanical environment is at the... level in the world. Figure 6: Epsilon Family 5. NEXT CHALLENGE After the... maiden flight, we are conducting Epsilon upgrade program. In order to... in realizing the lower cost Epsilon, a step by step approach has... launch vehicle. As next challenge, Epsilon will be improved in some... be replaced by Kanechika 6. CONCLUSION Epsilon’s first flight was excellent. All..., H. Ohtuka. “A year to launch: Japan’s Epsilon launch and its evolution”, 63th... first flight Test of the Epsilon Launch Vehicle” , 57th JASS, JAPAN... Operation and Flight Performance of Epsilon’s Propulsion Systems in the First...



Дата загрузки: 2017-06-14
Скачать документ
Скачать текст
0.1/5
... Hydrocarbons PAK p21-Activated Kinase 1 PBS Phosphate Buffered Saline PBST Phosphate... with sterile phosphate buffered saline (PBS (Oxoid, Hampshire, UK)), prior to... pellet was washed twice in PBS and incubated in lysis buffer....01%Tween20 and once with PBS to remove all the unbound... analysis, the beads washed with PBS were processed as mentioned in... Digestion The beads, following the PBS wash, were spun down at... coverslips were washed twice with PBS and then fixed using fixing... followed by three washes with PBS. The cells were then permeabilised... solution (0.5% NP40 made up in PBS) for 10 min and then..., 0.6% Triton X100 made up in PBS) overnight at 4°C. The following day.... Cells were washed again with PBS for 5 min. The coverslips were... washed twice with ice cold PBS. Cells were scraped gently from... was washed in ice cold PBS before being re-suspended in... initiation factor eIF-2B subunit epsilon Sulfide:quinone oxidoreductase WD repeat...-protein phosphatase PGAM5 Coatomer subunit epsilon Cleavage and polyadenylation specificity factor... SDR39U1 Oxidoreductase HTATIP2 Coatomer subunit epsilon Cleavage and polyadenylation specificity factor... initiation factor eIF-2B subunit epsilon 5'-AMP-activated protein kinase catalytic... A-IV 1 Eukaryotic translation elongation factor 1 epsilon-1 1 Dedicator of cytokinesis protein 9 1 Isoform... 1 subunit alpha T-complex protein 1 subunit epsilon 60S acidic ribosomal protein P0... nuclear protein Ran 14-3-3 protein epsilon Cullin-associated NEDD8-dissociated protein... tumor cells through a protein kinase C-epsilon/ERK/AP-1 signaling cascade. Cancer...



Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
0.09/5
... Anti-Met (N-Term) Custom Purified, PBS only Anti-phospho-a-Synuclein (Ser129... beta-3A/CD61, clone EP2417Y, PBS only Anti-phospho-Neurofilament M (Ser614... D1, clone EPR2241(IHC)-32, PBS only Anti-C/EBP ß (C-term), clone... 4.2.2; 100 µg Anti- IRS Custom (Purified, PBS only) Anti-phospho-IRS1 (Ser302..., 100ul Anti-Ubiquitin, Lys48 Custom PBS only Anti-Ubiquitin, Lys63-Specific... 25ug Anti-phospho MBP (CUSTOM PBS ONLY) A HU P15 INK4B (MTS2... 62 ANTI-GABA A RECEPTOR, CUSTOM, PBS O ANTI-EMT/ITK/TSK PC... 6.6.2; 200 µg Anti-Histone H3, clone 6.6.2, PBS only- MG ANTI TAFII250, CLONE... 4.47 Ms x Mg Anti-FAK, PBS only ANTI-FAK, PC 12...-phospho STAT6 (Tyr641) clone 16E12, PBS only AN-AKT/PKB, PH... Anti-Phosho-Acetyl CoA carboxylase, PBS only, 1mg/ml Anti-MBP..., CL 1H6 200UG Anti-phosphatidylserine, PBS only, Custom order ANTI-ING... Anti-CHD-1 Anti-phospho-IKK-epsilon (Ser172) Anti-NLRX1 (NOD9) Anti...) Anti-RSK1, custom 1mg/mL, PBS only Anti-IKKß (rabbit polyclonal... H2B PEPTIDE, BIOTIN. 100UG PKC EPSILON SUBSTRATE PEPT 1 MG CHKTIDE, BIOTINYLATED...), 100ml Custom-OEM Enz-free PBS (S-014), 100ml MBP, recombinant; 500...); 10mL NORMAL MOUSE AB - 10ML PBS/TWEEN20/AZIDE BUFFER PACK-5EA...-5EA ENTERO PKG, SLIDE-5EA PBS PACKET - SEE 5015 LIGHT DIAGNOSTICS..., 20ml Custom-OEM Enz-free PBS (S-014), Liter SECONDARY AB, GT... 14-3-3 EPSILON (C-TERM), RBX-100UL 14-3-3 EPSILON (C-TERM), RBX-30UL 14-3-3 EPSILON (N-TERM... Saline, Dulbecco's Phosphate Buffered Saline - D-PBS, 500ml EmbryoMax® 1X Dulbecco's Phosphate... Saline D-PBS w/o Calcium & Magnesium, 100ml D-PBS w/o Calcium & Magnesium - 10X, 500ml D-PBS with Calcium... - OEM Cell Dissociation Solution in PBS, Insect, 100m Custom - OEM 10x10mm... - OEM Cell Dissociation Solution in PBS, Insect (S-01 Custom - OEM Freezing...- Human IgG ( custom 1mg/mL, PBS only) Mouse anti-Human IgA... A Custom order 05-745R in PBS only Custom peptide Custom peptide....31, 100 ul Hu POL epsilon, Ms x 3C5.1, 100 ul LACV..., WITH AZIDE HLA-B27, Custom, PBS only, 4mg/mL Uni-Asia...-B27, clone HLA.ABC.m3, PBS only NUCLEAR SPLICEOSOMES, MS X-100UL...-HLA-B7, clone BB7.1, unconjugated, PBS only DNA-DS, MS X-100UG...- Tau, CloneTau-12 Anti-Tau, PBS only, CUSTOM Anti- Nitrated Tau... CREB, MSX-100UG Anti-CREB PBS only OCT-1, MSX-100UG Anti...-KLANTI-RSV (CUSTOM 2MG/ML, PBS ONLY) RSV, MSX 131-2G....2 ANTI-ATG2, CLONE 2H4.2(CUS PBS ONLY)-MG Anti-Anterior gradient... Anti-PP2A reg. subunit B56 epsilon (PPP2 Anti-Abl interactor 1, clone... MR-004-D Custom Fill-Modified D-PBS w/ BSA and Phenol Red, 500ml MR-006-B Modified D-PBS w/ BSA & Phenol Red, 100ml MR..., Liter Custom-OEM Emzyme Free PBS, 100ml PAP, GT-250UL Porcine... Enzyme Free Cell Dissociation Solution - PBS Based, 500ml Enzyme Free Cell Dissociation Solution PBS Based (1X), SERUM, HU, DEFIB...-C 0.025% Trypsin & 0.75mM EDTA in PBS w/o Calcium & Magnesium, SM-2004-C Snap...



Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
0.22/5
... density (absorbance) at 600 nm PBS Phosphate Buffered Saline PCR Polymerase... sepharose beads, previously washed with PBS with 0.1% Triton X-100 and 1mM... then washed three times with PBS with 0.2% Triton, 500mM NaCl, 20mM... reactions were washed once with PBS with 0.1% Triton X-100 and 1mM... were washed once with sterile PBS (Gibco, life technologies) to remove..., and were washed twice with PBS (except in the case of... were resuspended in 100μL of PBS and 4x Laemmli’s SDS-sample... the pellet was washed with PBS. Chilled Buffer A (10mM Tris-HCL... dishes were washed twice with PBS and collected by scraping. Cells... were usually blocked with 5% Milk/PBS-T for 1h at room temperature... by 3x 10min washes with PBS-T, and incubated for 1h at... primary antibody, diluted in 5% BSA/PBS-T with 0.02% NaN3 [Table 2.6]. Membranes... antibody, appropriately diluted in 3% milk/PBS-T [Table 2.7]. After another 3x10min washes..., cells were washed twice with PBS, and a relevant amount of cells... cells were washed twice in PBS and fixed with ice-cold... cells were washed twice with PBS and then blocked and permeabilized... washed 3 times for 5min in PBS and stained with 1μg/mL of.... Cells were washed twice with PBS and the coverslips were then..., the plates were washed with 1× PBS and fixed with 2 ml of... cells were washed twice with 1× PBS and allowed to dry completely... PE=1 SV=4 + T-complex protein 1 subunit epsilon OS=Homo sapiens GN=CCT5... (+1) 28 kDa 0 0 10 0 0 7 0 0 9 14-3-3 protein epsilon OS=Homo sapiens GN=YWHAE... kDa 5 0 0 2 0 0 3 0 0 Coatomer protein complex, subunit epsilon, isoform CRA_e OS=Homo sapiens... kDa 0 0 0 0 0 0 0 2 0 Eukaryotic translation elongation factor 1 epsilon-1 OS=Homo sapiens GN=EEF1E1... 0 0 22 0 0 24 0 T-complex protein 1 subunit epsilon OS=Homo sapiens GN=CCT5... initiation factor eIF-2B subunit epsilon OS=Homo sapiens GN=EIF2B5... + Translation Eukaryotic translation elongation factor 1 epsilon-1 + Eukaryotic translation initiation factor 1A...



Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
0.13/5
... NPY NT NTF Omgp p75NTR PBS PC12 PDE4 PDGF Interleukin Janus..., washed with phosphate buffered saline (PBS) (PAA, Yeovil, UK) 3 times blocked... with 4% paraformaldehyde (PFA) in 0.1M PBS at pH 7.4, until the tissue... with 4% PFA and 1% gluteraldehyde in PBS. Dissection was carried out on...-PGP9.5). Slides were washed in PBS several times, blocked in 10... 2 hours. After several rinses with PBS, the slides were incubated with... were rinsed with PBS and coverslips applied using PBS glycerol (1:8). Immunoreactivity was... Reverse: TGATTGCTGTTGAAGAGGTCG Probe TGGCTGCCGTGCCCACCCTAGA C/EBP Epsilon Forward: TTGACCTCTCCGCCTACATC NM_017095 Reverse: GGTAGTGAGGAAATGAAGGTG...), beta (p=<0.001), delta (p=0.004) and epsilon (p=0.017). However, in the spleen... 10 5 0 Alpha Beta Gamma Delta Epsilon C/EBP Isoform B SYBR Green - Spleen... 10 5 0 Alpha Beta Gamma Delta Epsilon C/EBP Isoform Fig. 14 SYBR... 10 * ** *** 5 0 Alpha Beta Gamma Delta Epsilon C/EBP Isoform B TaqMan - Spleen 70... Beta Gamma C/EBP Isoform Delta Epsilon Fig. 15 TaqMan real time... 7 Ipsilateral * 6 5 4 3 * 2 1 0 alpha beta gamma delta epsilon Fig. 17 C/EBP mRNA expression... (2001) The role of C/EBP(epsilon) in the terminal stages of... (1999) CCAAT/enhancer binding protein epsilon is a potential retinoid target gene... studies of CCAAT/enhancerbinding protein epsilon. J Biol Chem 276:17739-17746... human CCAAT/enhancer-binding protein epsilon. J Biol Chem 273:14796-14804... (1997) CCAAT/enhancer binding protein epsilon is preferentially up-regulated during...



Дата загрузки: 2017-04-09
Скачать документ
Скачать текст
0.24/5
... T, Isik N, Arikan S. (2003) The apolipoprotein E epsilon 4 allele is not a risk factor... and thin peripheral blood smears (PBS), which has a low cost; however... effective in diagnosis than the PBS method. On the other hand... was comparison of two methods PBS and PCR for diagnosis of....89% and 100%, compared to PBS. It was impossible to determine... all 900 students had negative PBS. In the hypoendemic area of... suitable in comparison of the PBS method. Long term follow up...ficant association of apoE epsilon 3/4 genotype, A reduced epsilon 3/4 genotype frequency (p<0.05) was... subjects with stroke and the epsilon E2/3 genotype frequency (p<0.05) was... previous stroke which suggests that epsilon 2/3 genotype is a survival factor for... was no association between apoE epsilon 4 allele and stroke. Conclusion: This...



Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
0.05/5
... NEDD4-2 nHEKs NMSC OCT p53 PBS PCR PDK1 PEG PH Full... FBS added Phosphate Buffered Saline (PBS) 137 mM Sodium chloride (NaCl... cells were washed with 5 ml PBS. Cells were trypsinized by adding... was washed 3 times in 4 ml PBS and stored in sterile conditions... cells were washed with 5 ml PBS. Cells were trypsinized by adding...) Stored at 40C Blocking Buffer PBS 5% (v/v) Normal goat / horse serum (Vector...) Stored at 40C Anti-fade PBS 90% (v/v) Glycerol (BDH) 100 mM.... Sections were briefly washed in PBS and then blocked for 1 hour... three times for 5 minutes in PBS + 0.1% Tween-20 (Sigma-Aldrich), before... three times for 5 minutes in PBS 87 + 0.1% Tween-20 in the... were then washed once in PBS for 5 minutes and mounted using... three times for 5 minutes in PBS and then blocked for 30... three times for 5 minutes in PBS + 0.1% Tween-20. Sections were incubated... three times for 5 minutes in PBS + 0.1% Tween-20, and incubated for... were then washed once in PBS + 0.1% Tween-20 for 5 minutes and... S (Sigma-Aldrich) 92 Blocking Buffer PBS / TBS 5% (w/v) milk (Marvel) Stored at... 7.5 pH 7.5 with HCl Wash Buffer PBS / TBS 0.1% (v/v) Tween-20 Stripping Buffer... in 1 ml pre-chilled PBS. The PBS was removed and cells were... were incubated on ice in PBS containing 5 mM EDTA and 1 mM..., which was then removed using PBS. 2.5.8 Antibody immunoblot and visualization For... Buffer in either TBS or PBS (TBS if the primary antibody was raised against a phosphorylated target; PBS for all others) and then... Buffer in either TBS or PBS (TBS if the primary antibody was raised against a phosphorylated target; PBS for all others) to remove... Wash Buffer and stored in PBS at 40C. 97 Table 5: Primary... K, Procter J, et al. PP2A(T61 epsilon) Is an Inhibitor of MAP4K3... protein kinase C alpha, -delta and -epsilon transgenic mice. International Journal of..., Wartman M, et al. Protein kinase C epsilon is an endogenous photosensitizer that... M, Condorelli G, et al. I kappa B kinase epsilon and TANK-binding kinase 1 activate...