Ракетный блок. Epsilon PBS. [Редактировать]

Дополнительные наименования

#НаименованияПоиск в новостяхПоиск в документах

Технические характеристики

1Длина, метра1.5
2Тяга (пустота), кНьютон0.4
3Удельный импульс, сек215
4Масса, кг300
5Диаметр, метра1.2

Найдено 204 документов по запросу «Epsilon PBS». [Перейти к поиску]

Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
... findings including expression of 14-3-3 epsilon protein. Global comparative gene expression... signalling and responses. The 14-3-3 epsilon protein was chosen for follow... for binding partners of 14-3-3 epsilon. Two ATP synthase subunits, one..., mass spectrometry, Western blotting (14-3-3 epsilon, Sdha, Pebp1, Atp5b and Bad...) 103 Page 9 3.7 Studies of 14-3-3 epsilon 3.7.1 Validation of experiments using samples... of cell death (Bad) 3.7.3 14-3-3 epsilon pull-down assay Bait protein... 6.2.4 Summary 220 7. Studies of 14-3-3 epsilon and Bad proteins 252 7.1 Validation... search results from the 14-3-3 epsilon pulldown analysis APPENDIX 10: Manuscript... Figure 4.8 Western blots of 14-3-3 epsilon (14-3-3ε), succinate 141 dehydrogenase (Sdha... (WB) analysis (right) for 14-3-3 epsilon (14-3-3ε), succinate dehydrogenase (Sdha), and... Figure 7.1 Western blots of 14-3-3 epsilon (14-3-3ε), succinate dehydrogenase (Shda), and... 10-18 (right) for 14-3-3 epsilon (14-3-3ε), succinate dehydrogenase (Sdha), and...-PAGE of the preliminary 14-3-3 epsilon pull-down assay Figure 7.5 Band... eluate from the preliminary 14-3-3 epsilon pull-down assay Figure 8.1 Mitochondrial... analysis. Specifically, antibodies for 14-3-3 epsilon (14-3-3ε), succinate dehydrogenase (Sdha), phosphatidylethanolamine... Page 106 3.7 Studies of 14-3-3 epsilon 3.7.1 Validation of experiments using samples... room temperature on a shaker. 3.7.3 14-3-3 epsilon pull-down assay A pull-down... 60µg of His-tagged 14-3-3 epsilon protein and a protein lysate prepared... synthase subunit beta 14-3-3 protein epsilon Cytochrome b-c1 complex subunit 6 ATP...-4A chain Others 14-3-3 protein epsilon 40S ribosomal protein SA Adenylyl... narrow-range 2DE experiments. 14-3-3 epsilon and the mitochondrial protein Sdha... to verify this analysis.  14-3-3 epsilon (14-3-3ε) An assay using a rabbit... Figure 4.8 Western blots of 14-3-3 epsilon (14-3-3ε), succinate dehydrogenase (Sdha), and...) analysis (right) for 14-33 epsilon (14-3-3ε), succinate dehydrogenase (Sdha), and..., ns = not significant. 14-3-3 epsilon (2DE) 14-3-3 epsilon (WB) One way ANOVA... 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide CAP, adenylate cyclase-associated... molecular chaperone related to the epsilon isoform found in our dataset... 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide desmin WD repeat domain... synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit 2 Cytoplasm transporter ATP5O ATP... protein kinase C, beta protein kinase C, epsilon superkiller viralicidic activity 2-like (S. cerevisiae... Glut-4, D-glucose and protein kinase C epsilon (Prkce). Glut-4 as a major hub...) interferon, gamma -immunoglobulin heavy constant epsilon interleukin 13 lectin, galactoside-binding.... Page 251 7. Studies of 14-3-3 epsilon and Bad proteins 7.1 Validation experiments... MI associated decrease in 14-3-3 epsilon observed in samples 1-9 was not...-3-3ε). Figure 7.1 Western blots of 14-3-3 epsilon (14-3-3ε), succinate dehydrogenase (Shda), and... 10-18 (right) for 14-3-3 epsilon (14-3-3ε), succinate dehydrogenase (Sdha), and... = not significant. 14-3-3 epsilon (10-18) 14-3-3 epsilon (1-9) One way ANOVA = 0.0006...-PAGE of the preliminary 14-3-3 epsilon pull-down assay A) & B) Two SDS... eluate from the preliminary 143-3 epsilon pull-down assay A) Bait flow... 14-3-3 protein epsilon BWB21 14-3-3 protein epsilon BWB22 14-3-3 protein epsilon Cytochrome c1, heme BWB24 protein, mitochondrial (mouse) 14-3-3 epsilon 14-3-3 epsilon 47kDa... confirmed the changes in 14-3-3 epsilon (Ywhae/14-3-3ε) expression, this is... afforded cardioprotection One protein, 14-3-3 epsilon is a very good candidate for... under investigation and although 143-3 epsilon is suggested to have early... proteomic analysis of protein kinase C epsilon signaling complexes in the normal... cardioprotection: Interplay between protein kinase C epsilon and delta in regulating glucose... NO RESULT 14-3-3 protein epsilon 14-3-3 protein epsilon 1430 1705 1705 2119... ATPB_RAT RSSA_RAT RSSA_RAT 14-3-3 protein epsilon Cationic trypsin precursor peptides only... repeat-containing protein 1 14-3-3 protein epsilon Abbrev. RefSeq ACCESSION UniProtKB/ Swiss.... similar to High affinity immunoglobulin epsilon receptor gamma-subunit precursor (FceRI... search results from the 14-3-3 epsilon pull-down assay Band identification... 1433E_RAT NO RESULT 14-3-3 protein epsilon 1549 106 Rattus 29155 4.63... 1433E_RAT 1433E_RAT 14-3-3 protein epsilon 14-3-3 protein epsilon 1779 337 19 31... BWB01 BWB01 1433E_RAT 14-3-3 protein epsilon 282 4 Rattus 29155 4.63 18... NO RESULT 14-3-3 protein epsilon 14-3-3 protein epsilon APPENDIX 9: continued Queries Species... 1433E_RAT 14-3-3 protein epsilon 14-3-3 protein epsilon 14-3-3 protein epsilon MASCOT Score 103... BWB25 BWB26 1433E_RAT 14-3-3 protein epsilon 1263 17 Rattus 29155 4.63... to PBS. The expression of two proteins (Shda and 14-3-3 epsilon) were... of expression levels of 14-3-3 epsilon with the normalized volumes shown... 6.15 Protein name 14-3-3 protein epsilon 40S ribosomal protein SA Adenylyl...

Дата загрузки: 2017-02-23
Скачать документ
Скачать текст
Скачать перевод
Посмотреть билингву
SSC14-P3-2 Epsilon Launch Vehicle - First Flight and ...-5210, Japan ABSTRACT The first Epsilon launch vehicle was successfully launched... (USC) on September 14th, 2013. Epsilon has achieved full mission success... planned orbit with high accuracy. Epsilon is now ready to offer... describes the main features of Epsilon launch vehicle, its mission profile... development plan is presented, as Epsilon has to become more cost... the result of Epsilon maiden flight qualification analysis. Epsilon launch vehicle is... small payloads. The purpose of Epsilon is to provide small satellites... efficient launch system are focused. Epsilon development was carried out with... integrator. The launch site for Epsilon is JAXA’s Uchinoura Space Center..., 3-hour flight from Tokyo. © JAXA Epsilon is able to carry 1.4 tons... Post Boost Stage (PBS). Figure 1: Epsilon Maiden Flight. Epsilon has two line-ups... the low end type without PBS. On the other hand, the... is the standard configuration plus PBS. The basic configuration is illustrated... The PBS is one of the liquid propulsion systems in Epsilon as.... Payload Fairing Liquid Propulsion System (PBS) (Optional Stage) Third Stage (KM... Diagram of PAF introduced to Epsilon system with ample and well... Configuration: 3 stages only Optional Configuration: PBS added to Standard Configuration vehicle... flights. Figure 2: Configuration of Epsilon Vehicle Epsilon launch vehicle is 24 m tall... well flight-proven H-2A’s ones. Epsilon has an autonomous check-system... 1 shows essential specifications of Epsilon of maiden flight. 2. EPSILON LAUNCH VEHICLE Table... 1: Epsilon’s Essential Specifications For Maiden Flight. Stage 1st 2nd 3rd PBS Specification...] Isp (Vac) [s] 4. MAIDEN FLIGHT RESULTS Epsilon’s first flight was successfully conducted... the solid propulsion phase, the PBS firing was conducted twice, which... firing of 50N thrusters x 4 on PBS. The purpose of Phase-A and... burn-out 3rd motor/PBS separation PBS phase-A start PBS phase-B start Satellite... high accuracy orbit insertion by Epsilon. Table 3: Separation Conditions Item Alt... liquid fuel, which reserved in a PBS fuel tank for CCAM sequence... to provide a safe distance between PBS and spacecraft), the launch vehicle... capture this market. The current Epsilon launch vehicle is able to... 2020, We intend to extend Epsilon’s capabilities to 2 tons from current... 2 tons. So if the future Epsilon’s capability is extended to 2 tons... 6 shows the Epsilon family under study. To expand the Epsilon capability with... boosters, and with more powerful PBS. Figure 5: Dynamic Longitudinal Acceleration under...-A. This result is indicated that Epsilon’s mechanical environment is at the... level in the world. Figure 6: Epsilon Family 5. NEXT CHALLENGE After the... maiden flight, we are conducting Epsilon upgrade program. In order to... in realizing the lower cost Epsilon, a step by step approach has... launch vehicle. As next challenge, Epsilon will be improved in some... be replaced by Kanechika 6. CONCLUSION Epsilon’s first flight was excellent. All..., H. Ohtuka. “A year to launch: Japan’s Epsilon launch and its evolution”, 63th... first flight Test of the Epsilon Launch Vehicle” , 57th JASS, JAPAN... Operation and Flight Performance of Epsilon’s Propulsion Systems in the First...

Дата загрузки: 2017-06-14
Скачать документ
Скачать текст
... Hydrocarbons PAK p21-Activated Kinase 1 PBS Phosphate Buffered Saline PBST Phosphate... with sterile phosphate buffered saline (PBS (Oxoid, Hampshire, UK)), prior to... pellet was washed twice in PBS and incubated in lysis buffer....01%Tween20 and once with PBS to remove all the unbound... analysis, the beads washed with PBS were processed as mentioned in... Digestion The beads, following the PBS wash, were spun down at... coverslips were washed twice with PBS and then fixed using fixing... followed by three washes with PBS. The cells were then permeabilised... solution (0.5% NP40 made up in PBS) for 10 min and then..., 0.6% Triton X100 made up in PBS) overnight at 4°C. The following day.... Cells were washed again with PBS for 5 min. The coverslips were... washed twice with ice cold PBS. Cells were scraped gently from... was washed in ice cold PBS before being re-suspended in... initiation factor eIF-2B subunit epsilon Sulfide:quinone oxidoreductase WD repeat...-protein phosphatase PGAM5 Coatomer subunit epsilon Cleavage and polyadenylation specificity factor... SDR39U1 Oxidoreductase HTATIP2 Coatomer subunit epsilon Cleavage and polyadenylation specificity factor... initiation factor eIF-2B subunit epsilon 5'-AMP-activated protein kinase catalytic... A-IV 1 Eukaryotic translation elongation factor 1 epsilon-1 1 Dedicator of cytokinesis protein 9 1 Isoform... 1 subunit alpha T-complex protein 1 subunit epsilon 60S acidic ribosomal protein P0... nuclear protein Ran 14-3-3 protein epsilon Cullin-associated NEDD8-dissociated protein... tumor cells through a protein kinase C-epsilon/ERK/AP-1 signaling cascade. Cancer...

Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
... Anti-Met (N-Term) Custom Purified, PBS only Anti-phospho-a-Synuclein (Ser129... beta-3A/CD61, clone EP2417Y, PBS only Anti-phospho-Neurofilament M (Ser614... D1, clone EPR2241(IHC)-32, PBS only Anti-C/EBP ß (C-term), clone... 4.2.2; 100 µg Anti- IRS Custom (Purified, PBS only) Anti-phospho-IRS1 (Ser302..., 100ul Anti-Ubiquitin, Lys48 Custom PBS only Anti-Ubiquitin, Lys63-Specific... 25ug Anti-phospho MBP (CUSTOM PBS ONLY) A HU P15 INK4B (MTS2... 62 ANTI-GABA A RECEPTOR, CUSTOM, PBS O ANTI-EMT/ITK/TSK PC... 6.6.2; 200 µg Anti-Histone H3, clone 6.6.2, PBS only- MG ANTI TAFII250, CLONE... 4.47 Ms x Mg Anti-FAK, PBS only ANTI-FAK, PC 12...-phospho STAT6 (Tyr641) clone 16E12, PBS only AN-AKT/PKB, PH... Anti-Phosho-Acetyl CoA carboxylase, PBS only, 1mg/ml Anti-MBP..., CL 1H6 200UG Anti-phosphatidylserine, PBS only, Custom order ANTI-ING... Anti-CHD-1 Anti-phospho-IKK-epsilon (Ser172) Anti-NLRX1 (NOD9) Anti...) Anti-RSK1, custom 1mg/mL, PBS only Anti-IKKß (rabbit polyclonal... H2B PEPTIDE, BIOTIN. 100UG PKC EPSILON SUBSTRATE PEPT 1 MG CHKTIDE, BIOTINYLATED...), 100ml Custom-OEM Enz-free PBS (S-014), 100ml MBP, recombinant; 500...); 10mL NORMAL MOUSE AB - 10ML PBS/TWEEN20/AZIDE BUFFER PACK-5EA...-5EA ENTERO PKG, SLIDE-5EA PBS PACKET - SEE 5015 LIGHT DIAGNOSTICS..., 20ml Custom-OEM Enz-free PBS (S-014), Liter SECONDARY AB, GT... 14-3-3 EPSILON (C-TERM), RBX-100UL 14-3-3 EPSILON (C-TERM), RBX-30UL 14-3-3 EPSILON (N-TERM... Saline, Dulbecco's Phosphate Buffered Saline - D-PBS, 500ml EmbryoMax® 1X Dulbecco's Phosphate... Saline D-PBS w/o Calcium & Magnesium, 100ml D-PBS w/o Calcium & Magnesium - 10X, 500ml D-PBS with Calcium... - OEM Cell Dissociation Solution in PBS, Insect, 100m Custom - OEM 10x10mm... - OEM Cell Dissociation Solution in PBS, Insect (S-01 Custom - OEM Freezing...- Human IgG ( custom 1mg/mL, PBS only) Mouse anti-Human IgA... A Custom order 05-745R in PBS only Custom peptide Custom peptide....31, 100 ul Hu POL epsilon, Ms x 3C5.1, 100 ul LACV..., WITH AZIDE HLA-B27, Custom, PBS only, 4mg/mL Uni-Asia...-B27, clone HLA.ABC.m3, PBS only NUCLEAR SPLICEOSOMES, MS X-100UL...-HLA-B7, clone BB7.1, unconjugated, PBS only DNA-DS, MS X-100UG...- Tau, CloneTau-12 Anti-Tau, PBS only, CUSTOM Anti- Nitrated Tau... CREB, MSX-100UG Anti-CREB PBS only OCT-1, MSX-100UG Anti...-KLANTI-RSV (CUSTOM 2MG/ML, PBS ONLY) RSV, MSX 131-2G....2 ANTI-ATG2, CLONE 2H4.2(CUS PBS ONLY)-MG Anti-Anterior gradient... Anti-PP2A reg. subunit B56 epsilon (PPP2 Anti-Abl interactor 1, clone... MR-004-D Custom Fill-Modified D-PBS w/ BSA and Phenol Red, 500ml MR-006-B Modified D-PBS w/ BSA & Phenol Red, 100ml MR..., Liter Custom-OEM Emzyme Free PBS, 100ml PAP, GT-250UL Porcine... Enzyme Free Cell Dissociation Solution - PBS Based, 500ml Enzyme Free Cell Dissociation Solution PBS Based (1X), SERUM, HU, DEFIB...-C 0.025% Trypsin & 0.75mM EDTA in PBS w/o Calcium & Magnesium, SM-2004-C Snap...

Дата загрузки: 2017-10-09
Скачать документ
Скачать текст
... (2013) 9125-13, Session 3 Semiconductor epsilon-near-zero nanooptics (Invited Paper..., Sandia National Labs. (United States) Epsilon-near-zero (ENZ) materials have... of guided modes near the epsilon zero frequency, termed ENZ modes... properties effectively, by employing an epsilon near-zero (ENZ) material as..., Session 11 Controlling coherence in epsilon-nearzero metamaterials (Invited Paper) Humeyra... extreme-parameter metamaterials, such as epsilon-nearzero (ENZ) have attracted a great...

Дата загрузки: 2017-12-26
Скачать документ
Скачать текст
...-МАТЕМАТИЧЕСКИЕ НАУКИ ПОЛУЧЕНИЕ ТОНКИХ ПЛЕНОК PbS МЕТОДОМ ХИМИЧЕСКОГО ОСАЖДЕНИЕ И ПРИМЕНЕНИЕ В СОЛНЕЧНЫХ... Нахчыванского Отделения НАН Азербайджана RECEIVING PbS THIN FILMS BY CHEMICAL BATH... химического осаждения получена тонкая пленка PbS c толшиной 102,1 нм. На полученных... эллипсометрии определены ε1 и ε2 – диэлектрические константы образцов PbS. Исследованы оптические свойства, определен спектр... тонкой пленки PbS. Рассмотрено возможности применение гетеропереходов Cd06Zn04S/PbS и CdS/PbS в солнечных фотоэлектрических... chemical bath deposition thin films PbS c Width 102.1 nm. On the... dielectric constant of the samples PbS. The optical properties determined by... film PbS. The possibility of using heterojunctions Cd06Zn04S / PbS and CdS / PbS in... на этих основах тонкие пленки PbS, исследования и применение. Для этой цели... нами были получены тонкие пленки PbS, проведены их рентгенографические -дифрактометриче- ские... полупроводников температурный коэффициент запрещенной зоны PbS положительно [3, с.14]. Известно, что при... могут заметно отличаться от крупнозернистого PbS [4, с. 279]. Существуют различные способы, такие... методов. Для получения тонких пленок PbS из химического осаждения использованный раствор...-коричневая тонкая пленка PbS. Механизм реакции для формирования PbS с помощью триэтаноламина (ТЭА.... 1. Рентгено - дифрактометрические спектры тонкой пленки PbS полученный химическим осаждением. Из рисунка..., что на образцах тонких пленок PbS, полученный химическим осаждением, расположение и интенсивности... стандартами для PbS. Для определение оптических параметров тонких пленок PbS полученным путем... 2 показан результаты измерения толщины образцов PbS. 22 ФИЗИКО-МАТЕМАТИЧЕСКИЕ НАУКИ В результате... волн 0 – 0,7 еВ. Рис.2. Толщина образцов PbS. а) шероховатость, б) тонкий слой, в) стеклянная подложка... график диэлектрических функции ε1 и ε2 тонких пленок PbS. Рис. 3. Экспериментальные и палические кривые диэлектрических функции ε1 и ε2 тонких пленок PbS. Как видно из графика все кривые диэлектрических функции ε1 и ε2 тонких пленок PbS почти совпадают. Для изучения оптических свойств тонкой пленки PbS на стеклянных подложках был использован... в области инфракрасного спектра тонкой пленки PbS существующий на фоне пиков функциональных... относящий только для тонкой пленки PbS, были построены зависимо- сти    (рис... соединений соотношения n= 1/2 выполняется, так как PbS является прямозонным полупроводником [9, с 272]. Чтобы... поглощения тонкой пленки PbS. Рис. 5. Зависимость    f   для тонкой пленки PbS полученный химическим... прямой линии с осью   тонкой пленки PbS полученного методом химического оса- E  0,37eV... эти значении для тонкой пленки PbS хорошо совпадает с литературными данными [10... солнечных фотоэлектрических установках применяются тонкопленочные PbS вместе с другими подходящими полупроводниковыми веществами... элемента на основе тонкой пленки PbS. На рис. 6 а) показано полная структура... установки на основе гетероперехода Cd06Zn04S/PbS, его поперечный разрез и схема распределения тонкопленочный р- тип слой PbS и n- тип слоя с Cd06Zn04S. На подложке... поглощающий слой был выбран в качестве 0,3 М PbS и обусловлен тем, что он имеет... 1 показано параметры преобразования гетероструктура Cd06Zn04S/ PbS. Лучший производительность рассмотренного фотовольтаического элемента... толщине 100нм Cd06Zn04S и 100-200нм PbS, ток короткого замыкания, Iкз = 0,031... солнечного элемента. оптимизированный гетероперехода CdS/PbS. Тонкая пленка CdS выбран для.... Исследована вольтамперная характеристика гетероперехода CdS/PbS. На рис. 7 показан результаты измерений... гетеропереходов Cd06Zn04S/ PbS и CdS /PbS. Параметры преобразования гетероструктура Cd06Zn04S/ PbS Параметры преобразования Значение... 2 Рис. 7. вольтамперная характеристика гетероперехода CdS/PbS. Проведенные исследовании этой устройства показали... химического осаждения получена тонкая пленка PbS c толшиной 102,1 нм, что считается.... Определены ε1 и ε2 – ди- электрические константы образцов PbS. Исследованы оптические свойства, определен спектр поглощения в инфракрасной области тонких пленок PbS. Из зависимости (αhν)-(ϯhν) установлена ширина запрещенной зоны для тонкой пленки PbS, полученного химическим осаждением соответствующее Eg.... Определены параметры преобразования гетероструктур Cd06Zn04S/PbS и CdS/PbS, где лучший производительность устанвки... график вольтамперной характеристик гетероперехода CdS/PbS. Получен- Международный Научный Институт "Educatio... для эффективного применения тонкой пленки PbS в солнечных фотоэлектрических установках. Список литературы..., and E. Darvasi, Optical properties of PbS- CdS 11. multilayers and mixed (CdS+PbS) thin films deposited on glass... Characterization of CdxZn1-xS and pbs Thin Films for Photovoltaic Applications..., M., Nair, M. and Nair, P. Revisiting CdS-PbS solar cell structure. Materials Research... (III) [2] и рентгенофлуорисцентным методом на приборе Epsilon 3. Величину сорбции Г (моль/кг) анионитом...

Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
... density (absorbance) at 600 nm PBS Phosphate Buffered Saline PCR Polymerase... sepharose beads, previously washed with PBS with 0.1% Triton X-100 and 1mM... then washed three times with PBS with 0.2% Triton, 500mM NaCl, 20mM... reactions were washed once with PBS with 0.1% Triton X-100 and 1mM... were washed once with sterile PBS (Gibco, life technologies) to remove..., and were washed twice with PBS (except in the case of... were resuspended in 100μL of PBS and 4x Laemmli’s SDS-sample... the pellet was washed with PBS. Chilled Buffer A (10mM Tris-HCL... dishes were washed twice with PBS and collected by scraping. Cells... were usually blocked with 5% Milk/PBS-T for 1h at room temperature... by 3x 10min washes with PBS-T, and incubated for 1h at... primary antibody, diluted in 5% BSA/PBS-T with 0.02% NaN3 [Table 2.6]. Membranes... antibody, appropriately diluted in 3% milk/PBS-T [Table 2.7]. After another 3x10min washes..., cells were washed twice with PBS, and a relevant amount of cells... cells were washed twice in PBS and fixed with ice-cold... cells were washed twice with PBS and then blocked and permeabilized... washed 3 times for 5min in PBS and stained with 1μg/mL of.... Cells were washed twice with PBS and the coverslips were then..., the plates were washed with 1× PBS and fixed with 2 ml of... cells were washed twice with 1× PBS and allowed to dry completely... PE=1 SV=4 + T-complex protein 1 subunit epsilon OS=Homo sapiens GN=CCT5... (+1) 28 kDa 0 0 10 0 0 7 0 0 9 14-3-3 protein epsilon OS=Homo sapiens GN=YWHAE... kDa 5 0 0 2 0 0 3 0 0 Coatomer protein complex, subunit epsilon, isoform CRA_e OS=Homo sapiens... kDa 0 0 0 0 0 0 0 2 0 Eukaryotic translation elongation factor 1 epsilon-1 OS=Homo sapiens GN=EEF1E1... 0 0 22 0 0 24 0 T-complex protein 1 subunit epsilon OS=Homo sapiens GN=CCT5... initiation factor eIF-2B subunit epsilon OS=Homo sapiens GN=EIF2B5... + Translation Eukaryotic translation elongation factor 1 epsilon-1 + Eukaryotic translation initiation factor 1A...

Дата загрузки: 2017-06-16
Скачать документ
Скачать текст
... replication PAGE Polyacrylamide gel electrophoresis PBS Phosphate buffered saline Pc Polycomb... in 1mL Phosphate Buffered Saline (PBS)/ 1mM MgCl2 /0.5mM CaCl2. The... were then fixed in 3% w/v paraformaldehyde/ PBS for 10 minutes, then washed 3 times in PBS. The cells that were transiently... washed 2 times in 100mM Glycine/ PBS for 10 minutes then washed 3 times in PBS. At this point the coverslips could be stored in PBS at 4C overnight. The cells were washed once in 0.2% TritonX-100/PBS for 10 minutes, then washed 3 times in 109 PBS. The cells were washed 3 times in 0.2% Bovine Serum Albumin (BSA)/PBS over a 5 minute period. The primary... was then added in 0.2% BSA/PBS for 45 minutes, then cells were washed 3 times in 0.2% BSA/PBS, over a 5 minute period. The secondary... at a 1/500 dilution in 0.2% BSA/PBS and incubated in darkness for... 3 times in 0.2% BSA/PBS, then washed twice in PBS. The coverslips were... pellet was resuspended in 100L PBS and freeze 110 thawed 3 times... cells were then washed in PBS, repelleted, then lysed in 200... pellet was then washed in PBS and repelleted. The cell pellet... an appropriate amount of 113 PBS and an equal volume of... milk powder, 0.1% Tween 20 in PBS) at RT for 1 hour. The... washed in 0.1% Tween 20 in PBS in between blocking and addition... washed twice in approximately 15mL PBS, then SDS lysis buffer added... washed twice in approximately 15mL PBS. The cells from each plate were then scraped into 2mL PBS, transferred to a 50mL Falcon tube... extracts Cells were scraped into PBS and are pelleted by centrifugation... removed and cells washed in PBS, then 5mL of lysis buffer... scraping the cells directly into PBS. The cell extracts were then... Ht31 (40) 316.AAC50431 Dystrobrevin-epsilon (40) 317.5VW21_HUMAN Microtubule-actin... adaptor-related protein complex AP-4 epsilon subunit (35) 380.S71752 giant...), 37 (9%) 425.S31975 14-3-3 protein epsilon, renal – mouse, 37 (12%) 426....Q96P05_HUMAN Transient receptor potential channel 4 epsilon splice variant (Transient receptor potential...), 37 (9%) 233.S31975 14-3-3 protein epsilon, renal – mouse, 37 (12%) 234....Q96P05_HUMAN Transient receptor potential channel 4 epsilon splice variant (Transient receptor potential...

Дата загрузки: 2017-06-15
Скачать документ
Скачать текст
... NPY NT NTF Omgp p75NTR PBS PC12 PDE4 PDGF Interleukin Janus..., washed with phosphate buffered saline (PBS) (PAA, Yeovil, UK) 3 times blocked... with 4% paraformaldehyde (PFA) in 0.1M PBS at pH 7.4, until the tissue... with 4% PFA and 1% gluteraldehyde in PBS. Dissection was carried out on...-PGP9.5). Slides were washed in PBS several times, blocked in 10... 2 hours. After several rinses with PBS, the slides were incubated with... were rinsed with PBS and coverslips applied using PBS glycerol (1:8). Immunoreactivity was... Reverse: TGATTGCTGTTGAAGAGGTCG Probe TGGCTGCCGTGCCCACCCTAGA C/EBP Epsilon Forward: TTGACCTCTCCGCCTACATC NM_017095 Reverse: GGTAGTGAGGAAATGAAGGTG...), beta (p=<0.001), delta (p=0.004) and epsilon (p=0.017). However, in the spleen... 10 5 0 Alpha Beta Gamma Delta Epsilon C/EBP Isoform B SYBR Green - Spleen... 10 5 0 Alpha Beta Gamma Delta Epsilon C/EBP Isoform Fig. 14 SYBR... 10 * ** *** 5 0 Alpha Beta Gamma Delta Epsilon C/EBP Isoform B TaqMan - Spleen 70... Beta Gamma C/EBP Isoform Delta Epsilon Fig. 15 TaqMan real time... 7 Ipsilateral * 6 5 4 3 * 2 1 0 alpha beta gamma delta epsilon Fig. 17 C/EBP mRNA expression... (2001) The role of C/EBP(epsilon) in the terminal stages of... (1999) CCAAT/enhancer binding protein epsilon is a potential retinoid target gene... studies of CCAAT/enhancerbinding protein epsilon. J Biol Chem 276:17739-17746... human CCAAT/enhancer-binding protein epsilon. J Biol Chem 273:14796-14804... (1997) CCAAT/enhancer binding protein epsilon is preferentially up-regulated during...

Дата загрузки: 2017-12-26
Скачать документ
Скачать текст
... Npro nt pac PACT PAMP PBS pDC PFU pH PIAS PIV5... infection in phosphate buffered saline (PBS) to remove all traces of... washed prior to infection in PBS to remove all traces of... were washed twice in sterile PBS in order to remove traces... fixed with 10% (v/v) formaldehyde in PBS for more than 30mins. Fixative... fixed with 10% formaldehyde in PBS on top of the agarose... (5% (v/v) NP-40, 10% (w/v) sucrose in PBS) for 15mins, and then washed in PBS supplemented with 1% FBS. Areas of... whole X31 (H3N2); diluted in PBS/1% FBS. Cells were washed with PBS/1% FBS, and monolayers incubated for ...). Monolayers were subsequently washed with PBS/1% FBS, and incubated for ~30mins... 5% (w/v) skimmed milk powder, 0.1% (v/v) Tween20 in PBS (blocking buffer), and incubated for... extensive washing with 0.1% Tween20 in PBS, the protein:antibody interactions were... final washing in 0.1% Tween20 in PBS, specific polypeptide bands were visualised... coverslips in 5% formaldehyde, 2% sucrose in PBS, and permeabilised with 0.5% NP-40, 10% sucrose in PBS for 5mins. The permeabilising buffer... were washed three times with PBS containing 1% FCS. Cells were incubated... for 1h, and washed with PBS to remove unbound antibody. Cells... buffer, and three times in PBS (1% FCS, 1% (w/v) sodium azide). For fluorescence... fixed with fixative (PBS, 5% formaldehyde, 2% sucrose), and washed with PBS (1% FCS, 1% sodium...-V antibody (10ȝg/sample) or with PBS (control) at 4oC overnight and then washed with ice-cold PBS (control) to wash away any... treated with EDTA (1mM) in PBS at 37oC for 5mins to... and centrifuged to remove EDTA/PBS at 1500rpm and then resuspended... 4ml/sample of ice-cold PBS. Cells were added to either.... Each plate was washed with PBS to wash away any unbound...., UK) in 1ml 1mM EDTA/PBS buffer for 1h at 50... were removed by washing with PBS. Selected cells were added onto...-V antibody (10ȝg/sample) or with PBS (control) at 4oC overnight. Both... then rinsed with ice-cold PBS (control) to wash away any... treated with EDTA (1mM) in PBS at 37oC for 5 mins to... was centrifuged to remove EDTA/PBS, resuspended to single cell suspension... 4ml/sample of ice-cold PBS, added to either the plate.... Each plate was rinsed with PBS to wash away any unbound... treated with EDTA (5mM) in PBS to detach the cells from... was centrifuged to remove EDTA/PBS, resuspended to single cell suspension... ice-cold EDTA (1mM) in PBS. Anti-PIV5-V antibody (5ȝg/ml) was... washed away with ice-cold PBS by centrifugation. Supernatant was removed... with 1ml fresh ice-cold PBS. Dynabeads ® Protein A (10ȝl/sample) were... were removed by washing with PBS. Selected cells were added onto... for inhibitor of kappaB kinase epsilon (IKKİ)/TBK1. J Biol Chem 283...